header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150323-8
Morpholino Name: MO1-ildr1b
Target: ildr1b (1)
Sequence:
5' - GTATTTTAATGTCAGCTTACCTTCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ildr1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ildr1b
Expressed Gene Anatomy Figures
ackr3b Fig. 8 from Sang et al., 2014
axin2 Fig. 8 from Sang et al., 2014
cxcr4b Fig. 8 from Sang et al., 2014
etv4 Fig. 8 from Sang et al., 2014
fgf3 Fig. 8 from Sang et al., 2014
fgf10a Fig. 8 from Sang et al., 2014
fgfr1a Fig. 8 from Sang et al., 2014
il17rd Fig. 8 from Sang et al., 2014
lef1 Fig. 8 from Sang et al., 2014
PHENOTYPE
Phenotype resulting from MO1-ildr1b
Phenotype of all Fish created by or utilizing MO1-ildr1b
Genome Resources:
CITATIONS (1)