ZFIN ID: ZDB-MRPHLNO-150309-5
Morpholino Name: MO3-myh9a
Target: myh9a (1)
Sequence:
5' - ATGTCTGAAACAGTCGTTTACAAGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-myh9a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-myh9a No data available
PHENOTYPE
Phenotype resulting from MO3-myh9a
Phenotype Figures
actin filament bundle distribution disrupted, abnormal Fig. 6 with image from Gutzman et al., 2015
eye morphology, abnormal Fig. S2 with image from Gutzman et al., 2015
heart morphology, abnormal Fig. S2 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell increased length, abnormal Fig. 4 with image from Gutzman et al., 2015
neuroepithelial cell actin filament decreased accumulation midbrain hindbrain boundary apical region, abnormal Fig. 6 with image from Gutzman et al., 2015
pigmentation disrupted, abnormal Fig. S2 with image from Gutzman et al., 2015
post-vent region curved, abnormal Fig. S2 with image from Gutzman et al., 2015
somite morphology, abnormal Fig. S2 with image from Gutzman et al., 2015

Phenotype of all Fish created by or utilizing MO3-myh9a
Phenotype Fish Conditions Figures
somite morphology, abnormal AB + MO3-myh9a standard conditions Fig. S2 with image from Gutzman et al., 2015
neuroepithelial cell actin filament decreased accumulation midbrain hindbrain boundary apical region, abnormal AB + MO3-myh9a standard conditions Fig. 6 with image from Gutzman et al., 2015
pigmentation disrupted, abnormal AB + MO3-myh9a standard conditions Fig. S2 with image from Gutzman et al., 2015
actin filament bundle distribution disrupted, abnormal AB + MO3-myh9a standard conditions Fig. 6 with image from Gutzman et al., 2015
eye morphology, abnormal AB + MO3-myh9a standard conditions Fig. S2 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell increased length, abnormal AB + MO3-myh9a standard conditions Fig. 4 with image from Gutzman et al., 2015
heart morphology, abnormal AB + MO3-myh9a standard conditions Fig. S2 with image from Gutzman et al., 2015
post-vent region curved, abnormal AB + MO3-myh9a standard conditions Fig. S2 with image from Gutzman et al., 2015
OTHER MO3-myh9a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)