header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150216-2
Morpholino Name: MO3-dmrta2
Target: dmrta2 (1)
Sequence:
5' - TTTGATTCTCCTGGAATAGATTTGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-dmrta2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-dmrta2 No data available
PHENOTYPE
Phenotype resulting from MO3-dmrta2
No data available

Phenotype of all Fish created by or utilizing MO3-dmrta2
Phenotype Fish Conditions Figures
adenohypophysis has extra parts of type follicle stimulating hormone secreting cell, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 6 from Graf et al., 2015
rostral pars anterior prolactin secreting cell dispersed, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 7 from Graf et al., 2015
adenohypophysis has fewer parts of type adrenocorticotropic hormone secreting cell, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 4Fig. 6 from Graf et al., 2015
adenohypophysis apoptotic process increased occurrence, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 7 from Graf et al., 2015
prolactin secreting cell development decreased process quality, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 7 from Graf et al., 2015
adenohypophysis has fewer parts of type prolactin secreting cell, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 7 from Graf et al., 2015
adenohypophysis corticotropin hormone secreting cell differentiation decreased occurrence, abnormal WT + MO2-dmrta2 + MO3-dmrta2 standard conditions Fig. 4Fig. 6 from Graf et al., 2015
adenohypophysis corticotropin hormone secreting cell differentiation decreased occurrence, abnormal WT + MO2-dmrta2 + MO3-dmrta2 + MO4-tp53 standard conditions Fig. 4 from Graf et al., 2015
adenohypophysis has fewer parts of type adrenocorticotropic hormone secreting cell, abnormal WT + MO2-dmrta2 + MO3-dmrta2 + MO4-tp53 standard conditions Fig. 4 from Graf et al., 2015
OTHER MO3-dmrta2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)