ZFIN ID: ZDB-MRPHLNO-150212-5
Morpholino Name: MO1-asip2b
Target: asip2b (1)
Previous Names: MO1-agrp2, agrp2 ATG MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTCAGCACCGCCGTCGTCATTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-asip2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-asip2b
Expressed Gene Anatomy Figures
pmch whole organism Fig. 4 from Zhang et al., 2010
pmchl whole organism Fig. 4 from Zhang et al., 2010
PHENOTYPE 
Phenotype resulting from MO1-asip2b
Phenotype Figures
hypothalamus neuron decreased amount, abnormal Fig. 4 from Zhang et al., 2010
melanocyte melanosome dispersed, abnormal Fig. 3 from Zhang et al., 2010
trunk melanosome increased area, abnormal Fig. 3 from Zhang et al., 2010

Phenotype of all Fish created by or utilizing MO1-asip2b
Phenotype Fish Conditions Figures
trunk melanosome increased area, abnormal WT + MO1-asip2b standard conditions Fig. 3 from Zhang et al., 2010
hypothalamus neuron decreased amount, abnormal WT + MO1-asip2b standard conditions Fig. 4 from Zhang et al., 2010
melanocyte melanosome dispersed, abnormal WT + MO1-asip2b standard conditions Fig. 3 from Zhang et al., 2010
OTHER MO1-asip2b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)