ZFIN ID: ZDB-MRPHLNO-150210-3
Morpholino Name: MO1-pmch
Target: pmch (1)
Sequence:
5' - AGATGATTATGTAGGAAGATGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pmch No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pmch No data available
PHENOTYPE 
Phenotype resulting from MO1-pmch
No data available

Phenotype of all Fish created by or utilizing MO1-pmch
No data available
OTHER MO1-pmch MORPHOLINO PAGESNo links to external sites
CITATIONS (1)