ZFIN ID: ZDB-MRPHLNO-150130-1
Morpholino Name: MO1-id1
Target: id1 (1)
Sequence:
5' - TAGGTCCCACAACTTTCATTTTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-id1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-id1
Expressed Gene Anatomy Figures
her2 Fig. 5 with image from Gao et al., 2015
PHENOTYPE
Phenotype resulting from MO1-id1
Phenotype Figures
brain neural precursor cell proliferation decreased occurrence, abnormal Fig. 6 with image from Gao et al., 2015

Phenotype of all Fish created by or utilizing MO1-id1
Phenotype Fish Conditions Figures
cell population proliferation increased occurrence, abnormal WT + MO1-id1 perforation Fig. 5 from Rodriguez Viales et al., 2015
radial glial cell proliferative, abnormal WT + MO1-id1 perforation Fig. 5 from Rodriguez Viales et al., 2015
brain neural precursor cell proliferation decreased occurrence, abnormal WT + MO1-id1 standard conditions Fig. 6 with image from Gao et al., 2015
generation of neurons increased occurrence, abnormal WT + MO1-id1 perforation Fig. 5 from Rodriguez Viales et al., 2015
brain neural precursor cell proliferation decreased occurrence, abnormal pku322Tg + MO1-id1 standard conditions Fig. 6 with image from Gao et al., 2015
OTHER MO1-id1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)