Morpholino

MO1-gas2l3

ID

ZDB-MRPHLNO-150106-3

Name

MO1-gas2l3

Previous Names

None

Target

Sequence

5' - ACCAAGCCTGAAACCAGAGGAGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gas2l3

No data available

Phenotype

Phenotype resulting from MO1-gas2l3

Phenotype	Fish	Figures
brain decreased size, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
brain morphology, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
brain development disrupted, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
cell proliferation in hindbrain disrupted, abnormal	AB + MO1-gas2l3	Fig. 4 from Sharaby et al., 2014
cell proliferation in midbrain disrupted, abnormal	AB + MO1-gas2l3	Fig. 4 from Sharaby et al., 2014
neural tube asymmetrical, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
neural tube decreased width, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
telencephalon protruding, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
ventricular system closed, abnormal	AB + MO1-gas2l3	Fig. 4 from Sharaby et al., 2014
ventricular system decreased size, abnormal	AB + MO1-gas2l3	Fig. 3 from Sharaby et al., 2014
ventricular system morphology, abnormal	AB + MO1-gas2l3	Fig. 4 from Sharaby et al., 2014
ventricular system development disrupted, abnormal	AB + MO1-gas2l3	Fig. 4 from Sharaby et al., 2014

Phenotype of all Fish created by or utilizing MO1-gas2l3

Phenotype	Fish	Conditions	Figures
neural tube decreased width, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
brain development disrupted, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
brain morphology, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
telencephalon protruding, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
brain decreased size, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
ventricular system closed, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 4 from Sharaby et al., 2014
neural tube asymmetrical, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
ventricular system morphology, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 4 from Sharaby et al., 2014
ventricular system development disrupted, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 4 from Sharaby et al., 2014
ventricular system decreased size, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 3 from Sharaby et al., 2014
cell proliferation in midbrain disrupted, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 4 from Sharaby et al., 2014
cell proliferation in hindbrain disrupted, abnormal	AB + MO1-gas2l3	standard conditions	Fig. 4 from Sharaby et al., 2014

Citations