Morpholino

MO2-grhl3

ID
ZDB-MRPHLNO-141230-25
Name
MO2-grhl3
Previous Names
None
Target
Sequence
5' - TGAGAGCCTCAATCTCCTTGGTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-grhl3
Expressed Gene Anatomy Figures
dlx2a Fig. 2 with image from Dworkin et al., 2014
dlx3b Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Dworkin et al., 2014
edn1 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Dworkin et al., 2014
en2a Fig. 2 with image from Miles et al., 2017
hand2 Fig. 3 with image,  Fig. 5 with image from Dworkin et al., 2014
snai1b Fig. 2 with image from Dworkin et al., 2014
sox9b Fig. 2 with image from Dworkin et al., 2014
tfap2a Fig. 2 with image from Dworkin et al., 2014
Phenotype
Phenotype resulting from MO2-grhl3
Phenotype Fish Figures
basihyal cartilage aplastic, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
ceratobranchial cartilage aplastic, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
ceratohyal cartilage hypoplastic, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
Meckel's cartilage hypoplastic, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
midbrain hindbrain boundary neural tube morphology, abnormal TU + MO2-grhl3 Fig. 2 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO2-grhl3 Fig. 2 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO2-grhl3 Fig. 2 with image from Miles et al., 2017
mouth malformed, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
palatoquadrate arch hypoplastic, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
periderm cell increased size, abnormal TU + MO2-grhl3 Fig. 3 with image from Miles et al., 2017
pharynx apoptotic process increased process quality, abnormal WT + MO2-grhl3 Fig. 2 with image from Dworkin et al., 2014
post-vent region curved dorsal, abnormal TU + MO2-grhl3 Fig. 2 with image from Miles et al., 2017
splanchnocranium hypoplastic, abnormal WT + MO2-grhl3 Fig. 1 with image from Dworkin et al., 2014
ventral mandibular arch cell population proliferation decreased process quality, abnormal WT + MO2-grhl3 Fig. 6 with image from Dworkin et al., 2014
whole organism anterior-posterior axis decreased length, abnormal TU + MO2-grhl3 Fig. 2 with image from Miles et al., 2017
Phenotype of all Fish created by or utilizing MO2-grhl3
Phenotype Fish Conditions Figures
whole organism anterior-posterior axis decreased length, abnormal TU + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
periderm cell increased size, abnormal TU + MO2-grhl3 standard conditions Fig. 3 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, abnormal TU + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
post-vent region curved dorsal, abnormal TU + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
pharynx apoptotic process increased process quality, abnormal WT + MO2-grhl3 standard conditions Fig. 2 with image from Dworkin et al., 2014
mouth malformed, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
basihyal cartilage aplastic, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
palatoquadrate arch hypoplastic, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
splanchnocranium hypoplastic, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
ceratobranchial cartilage aplastic, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
ventral mandibular arch cell population proliferation decreased process quality, abnormal WT + MO2-grhl3 standard conditions Fig. 6 with image from Dworkin et al., 2014
Meckel's cartilage hypoplastic, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
ceratohyal cartilage hypoplastic, abnormal WT + MO2-grhl3 standard conditions Fig. 1 with image from Dworkin et al., 2014
whole organism anterior-posterior axis decreased length, abnormal TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
neural tube closure incomplete, abnormal TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
periderm cell increased size, exacerbated TU + MO1-arhgef19 + MO2-grhl3 standard conditions Fig. 3 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO1-cdc42se1 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
whole organism anterior-posterior axis decreased length, abnormal TU + MO1-cdc42se1 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO1-cdc42se1 + MO2-grhl3 standard conditions Fig. 2 with image from Miles et al., 2017
midbrain hindbrain boundary neural tube morphology, exacerbated TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
post-vent region agenesis, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
somite shape, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
notochord increased width, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
whole organism anterior-posterior axis decreased length, exacerbated TU + MO2-grhl2b + MO2-grhl3 standard conditions Fig. 4 with image from Miles et al., 2017
cartilaginous joint aplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
ceratohyal cartilage hypoplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
palatoquadrate arch hypoplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
Meckel's cartilage hypoplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
basihyal cartilage aplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
ceratobranchial cartilage aplastic, abnormal WT + MO1-edn1 + MO2-grhl3 standard conditions Fig. 4 with image from Dworkin et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.