ZFIN ID: ZDB-MRPHLNO-141217-1
Morpholino Name: MO6-tbx16
Target: tbx16 (1)
Sequence:
5' - CTCTGATAGCCTGCATTATTTAGCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-tbx16 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-tbx16 No data available
PHENOTYPE
Phenotype resulting from MO6-tbx16
No data available

Phenotype of all Fish created by or utilizing MO6-tbx16
No data available
OTHER MO6-tbx16 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)