header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-141208-4
Morpholino Name: MO3-cxxc1b
Target: cxxc1b (1)
Sequence:
5' - TATCAGACATTTCGCTGTCCATCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cxxc1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cxxc1b No data available
PHENOTYPE
Phenotype resulting from MO3-cxxc1b
No data available

Phenotype of all Fish created by or utilizing MO3-cxxc1b
No data available
OTHER MO3-cxxc1b MORPHOLINO PAGESNo links to external sites
CITATIONS (1)