header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-141113-2
Morpholino Name: MO1-meox1
Target: meox1 (1)
Sequence:
5' - CTGGCTGACTGTTCCATACTGAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-meox1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-meox1
Expressed Gene Anatomy Figures
myb Fig. S8 from Nguyen et al., 2014
runx1 Fig. S8 from Nguyen et al., 2014
PHENOTYPE
Phenotype resulting from MO1-meox1
No data available

Phenotype of all Fish created by or utilizing MO1-meox1
No data available
Genome Resources:
CITATIONS (1)