ZFIN ID: ZDB-MRPHLNO-141106-1
Morpholino Name: MO1-pgm5
Target: pgm5 (1)
Sequence:
5' - ATGAGATAAGAGGCAAGCACCCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pgm5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pgm5 No data available
PHENOTYPE
Phenotype resulting from MO1-pgm5
Phenotype Figures
musculoskeletal movement decreased process quality, abnormal Fig. 7 from Molt et al., 2014
skeletal muscle disorganized, abnormal Fig. 7 from Molt et al., 2014
skeletal muscle morphology, abnormal Fig. 7 from Molt et al., 2014
skeletal muscle paralysed, abnormal Fig. 7 from Molt et al., 2014
skeletal muscle cell detached from somite border, abnormal Fig. 7 from Molt et al., 2014
striated muscle cell misaligned with striated muscle cell, abnormal Fig. 7 from Molt et al., 2014
striated muscle cell myofibril disorganized, abnormal Fig. 7 from Molt et al., 2014
striated muscle cell myofilament detached from myoseptum, abnormal Fig. 7 from Molt et al., 2014
striated muscle cell myofilament disorganized, abnormal Fig. 7 from Molt et al., 2014
striated muscle cell Z disc misaligned with striated muscle cell Z disc, abnormal Fig. 7 from Molt et al., 2014

Phenotype of all Fish created by or utilizing MO1-pgm5
Phenotype Fish Conditions Figures
striated muscle cell Z disc misaligned with striated muscle cell Z disc, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
striated muscle cell misaligned with striated muscle cell, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
skeletal muscle paralysed, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
skeletal muscle cell detached from somite border, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
striated muscle cell myofilament detached from myoseptum, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
striated muscle cell myofilament disorganized, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
skeletal muscle disorganized, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
musculoskeletal movement decreased process quality, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
striated muscle cell myofibril disorganized, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
skeletal muscle morphology, abnormal WT + MO1-pgm5 standard conditions Fig. 7 from Molt et al., 2014
OTHER MO1-pgm5 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)