Morpholino

MO4-dlx5a

ID
ZDB-MRPHLNO-140923-10
Name
MO4-dlx5a
Previous Names
None
Target
Sequence
5' - TCCTTCTGTCGAATACTCCAGTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-dlx5a
No data available
Phenotype
Phenotype resulting from MO4-dlx5a
Phenotype Fish Figures
pectoral fin bud hypoplastic, abnormal WT + MO4-dlx5a Fig. 3 with image from Heude et al., 2014
post-vent region curled, abnormal WT + MO4-dlx5a Fig. 3 with image from Heude et al., 2014
Phenotype of all Fish created by or utilizing MO4-dlx5a
Phenotype Fish Conditions Figures
pectoral fin bud hypoplastic, abnormal WT + MO4-dlx5a standard conditions Fig. 3 with image from Heude et al., 2014
post-vent region curled, abnormal WT + MO4-dlx5a standard conditions Fig. 3 with image from Heude et al., 2014
opercle decreased size, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Heude et al., 2014
somite U-shaped, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
notochord bent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
cranium malformed, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 3 with image from Heude et al., 2014
median fin fold morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 6 with image from Heude et al., 2014
neural crest cell mislocalised, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
notochord undulate, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 6 with image from Heude et al., 2014
somite foxd3 expression increased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
pectoral fin bud absent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 3 with image,  Fig. 4 with image from Heude et al., 2014
neural rod cell ncam3 expression decreased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 4 with image from Narboux-Neme et al., 2019
primary motor neuron neuromuscular junction absent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
somite morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
somite cdh2 expression increased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
primary motor neuron ab-sv2 labeling decreased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
cleithrum absent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Heude et al., 2014
primary motor neuron neuromuscular junction morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
neural tube msx1b expression spatial pattern, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
fin fold actinotrichium absent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 7 with image from Heude et al., 2014
central canal morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
median fin fold posterior region morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 7 with image from Heude et al., 2014
somite border morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
neural tube morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
neural tube msx1b expression decreased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
mesenchyme median fin fold disorganized, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 7 with image from Heude et al., 2014
whole organism decreased size, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 3 with image from Heude et al., 2014
spinal cord malformed, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
pectoral fin bud hypoplastic, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 3 with image,  Fig. 4 with image from Heude et al., 2014
spinal cord morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
neural crest cell foxd3 expression spatial pattern, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
post-vent region sinuous, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 1 with image from Narboux-Neme et al., 2019
post-vent region curled, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 3 with image,  Fig. 6 with image from Heude et al., 2014
neural tube decreased size, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Narboux-Neme et al., 2019
neural rod cell msx1b expression decreased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 4 with image from Narboux-Neme et al., 2019
notochord increased size, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 6 with image from Heude et al., 2014
spinal cord bent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
ceratobranchial 5 cartilage absent, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 5 with image from Heude et al., 2014
neural rod cell cdh2 expression decreased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 4 with image from Narboux-Neme et al., 2019
notochord kinked, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
median fin fold decreased width, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 7 with image from Heude et al., 2014
spinal cord bmp4 expression decreased amount, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
notochord morphology, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. S3 with image from Narboux-Neme et al., 2019
neural keel cell mislocalised, abnormal WT + MO1-dlx6a + MO4-dlx5a standard conditions Fig. 4 with image from Narboux-Neme et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.