Morpholino

MO2-ambra1a

ID
ZDB-MRPHLNO-140918-6
Name
MO2-ambra1a
Previous Names
  • exon 3-intron 3 junction (1)
Target
Sequence
5' - TGTAATCAAAGTGGTCTTACCTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ambra1a
Phenotype
Phenotype resulting from MO2-ambra1a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-ambra1a Fig. 12 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO2-ambra1a Fig. 11 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO2-ambra1a Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO2-ambra1a Fig. 6Fig. 9 from Benato et al., 2013
fast muscle cell undulate, abnormal AB + MO2-ambra1a Fig. 9 with image from Skobo et al., 2014
fourth ventricle hydrocephalic, abnormal WT + MO2-ambra1a Fig. 9 from Benato et al., 2013
head apoptotic, abnormal WT + MO2-ambra1a Fig. 12 from Benato et al., 2013
head decreased size, abnormal WT + MO2-ambra1a Fig. 6 from Benato et al., 2013
intersegmental vessel morphology, abnormal WT + MO2-ambra1a Fig. S3 from Benato et al., 2013
muscle sarcomere disorganized, abnormal AB + MO2-ambra1a Fig. 7 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO2-ambra1a Fig. 3 with imageFig. 7 with image from Skobo et al., 2014
myoseptum decreased thickness, abnormal AB + MO2-ambra1a Fig. 3 with image from Skobo et al., 2014
otic vesicle decreased size, abnormal WT + MO2-ambra1a Fig. 9 from Benato et al., 2013
otolith decreased size, abnormal WT + MO2-ambra1a Fig. 6 from Benato et al., 2013
pericardium edematous, abnormal WT + MO2-ambra1a Fig. 9 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO2-ambra1a Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO2-ambra1a Fig. 6Fig. 9 from Benato et al., 2013
subintestinal vein morphology, abnormal WT + MO2-ambra1a Fig. S3 from Benato et al., 2013
trunk decreased size, abnormal WT + MO2-ambra1a Fig. 6 from Benato et al., 2013
whole organism dead, abnormal WT + MO2-ambra1a text only from Benato et al., 2013
whole organism deformed, abnormal WT + MO2-ambra1a Fig. 6 from Benato et al., 2013
Phenotype of all Fish created by or utilizing MO2-ambra1a
Phenotype Fish Conditions Figures
muscle sarcomere disorganized, abnormal AB + MO2-ambra1a standard conditions Fig. 7 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO2-ambra1a standard conditions Fig. 3 with imageFig. 7 with image from Skobo et al., 2014
fast muscle cell undulate, abnormal AB + MO2-ambra1a standard conditions Fig. 9 with image from Skobo et al., 2014
myoseptum decreased thickness, abnormal AB + MO2-ambra1a standard conditions Fig. 3 with image from Skobo et al., 2014
whole organism dead, abnormal WT + MO2-ambra1a standard conditions text only from Benato et al., 2013
otic vesicle decreased size, abnormal WT + MO2-ambra1a standard conditions Fig. 9 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO2-ambra1a standard conditions Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO2-ambra1a standard conditions Fig. 6Fig. 9 from Benato et al., 2013
subintestinal vein morphology, abnormal WT + MO2-ambra1a standard conditions Fig. S3 from Benato et al., 2013
eye decreased size, abnormal WT + MO2-ambra1a standard conditions Fig. 6Fig. 9 from Benato et al., 2013
pericardium edematous, abnormal WT + MO2-ambra1a standard conditions Fig. 9 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO2-ambra1a standard conditions Fig. 9 from Benato et al., 2013
whole organism deformed, abnormal WT + MO2-ambra1a standard conditions Fig. 6 from Benato et al., 2013
trunk decreased size, abnormal WT + MO2-ambra1a standard conditions Fig. 6 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO2-ambra1a standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO2-ambra1a standard conditions Fig. 6 from Benato et al., 2013
head apoptotic, abnormal WT + MO2-ambra1a standard conditions Fig. 12 from Benato et al., 2013
apoptotic process increased occurrence, abnormal WT + MO2-ambra1a standard conditions Fig. 12 from Benato et al., 2013
intersegmental vessel morphology, abnormal WT + MO2-ambra1a standard conditions Fig. S3 from Benato et al., 2013
otolith decreased size, abnormal WT + MO2-ambra1a standard conditions Fig. 6 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO2-ambra1a standard conditions Fig. 11 from Benato et al., 2013
Citations