header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140707-1
Morpholino Name: MO3-ednraa
Target: ednraa (1)
Sequence:
5' - CCGCTCTTTGATTTCCAGATGAGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR. The author was contacted and provided this corrected morpholino sequence.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-ednraa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-ednraa
Expressed Gene Anatomy Figures
atp6v1aa Fig. 5 from Guh et al., 2014
ca2 Fig. 6 from Guh et al., 2014
ca15a Fig. 6 from Guh et al., 2014
rhcgb Fig. 6 from Guh et al., 2014
slc4a1b Fig. 6 from Guh et al., 2014
PHENOTYPE
Phenotype resulting from MO3-ednraa
Phenotype of all Fish created by or utilizing MO3-ednraa
OTHER MO3-ednraa MORPHOLINO PAGESNo links to external sites
CITATIONS (1)