Morpholino
MO6-mgaa
- ID
- ZDB-MRPHLNO-140701-4
- Name
- MO6-mgaa
- Previous Names
-
- mgaTL3MO (1)
- Target
- Sequence
-
5' - TCTGGATAGCTTCTGACCCTCTCAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-mgaa
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| bmp2b |
Fig. 2 
from Sun et al., 2014 |
|
| egr2b |
Fig. 2
from Sun et al., 2014 |
|
| gata1a |
Fig. 2
from Sun et al., 2014 |
Phenotype
Phenotype resulting from MO6-mgaa
| Phenotype | Fish | Figures |
|---|---|---|
| neuroectoderm wholly dorsalized, abnormal | WT + MO6-mgaa |
Fig. 2
from Sun et al., 2014 |
| ventral fin fold absent, abnormal | WT + MO6-mgaa |
Fig. 2
from Sun et al., 2014 |
Phenotype of all Fish created by or utilizing MO6-mgaa
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| ventral fin fold absent, abnormal | WT + MO6-mgaa | standard conditions |
Fig. 2
from Sun et al., 2014 |
| neuroectoderm wholly dorsalized, abnormal | WT + MO6-mgaa | standard conditions |
Fig. 2
from Sun et al., 2014 |
Citations