header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140620-5
Morpholino Name: MO1-crlf1a
Target: crlf1a (1)
Previous Name: crlf1a (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAATAAGCAGATCATCTTACGAGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-crlf1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-crlf1a No data available
PHENOTYPE
Phenotype resulting from MO1-crlf1a
No data available

Phenotype of all Fish created by or utilizing MO1-crlf1a
OTHER MO1-crlf1a MORPHOLINO PAGES No links to external sites
CITATIONS (1)