ZFIN ID: ZDB-MRPHLNO-140604-1
Morpholino Name: MO3-cdk5
Target: cdk5 (1)
Sequence:
5' - CCAGCTTCTCATACTTTTGCATGGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-cdk5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-cdk5 No data available
PHENOTYPE 
Phenotype resulting from MO3-cdk5
No data available

Phenotype of all Fish created by or utilizing MO3-cdk5
No data available
OTHER MO3-cdk5 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)