Morpholino

MO2-klhl41b

ID

ZDB-MRPHLNO-140213-7

Name

MO2-klhl41b

Previous Names

None

Target

klhl41b (1)

Sequence

5' - TCAAAGATGAACTCATACTCGGTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-klhl41b

No data available

Phenotype

Phenotype resulting from MO2-klhl41b

Phenotype	Fish	Figures
skeletal muscle decreased size, abnormal	WT + MO2-klhl41b	Fig. 4 from Gupta et al., 2013
skeletal muscle refractivity, abnormal	WT + MO2-klhl41b	Fig. 3 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal	WT + MO2-klhl41b	Fig. 4 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal	WT + MO2-klhl41b	Fig. S7 from Gupta et al., 2013
skeletal muscle Z disc increased thickness, abnormal	WT + MO2-klhl41b	Fig. 4 from Gupta et al., 2013
thigmotaxis disrupted, abnormal	WT + MO2-klhl41b	Fig. SMovie4 from Gupta et al., 2013
whole organism dead, abnormal	WT + MO2-klhl41b	Fig. 3 from Gupta et al., 2013

Phenotype of all Fish created by or utilizing MO2-klhl41b

Phenotype	Fish	Conditions	Figures
skeletal muscle myofibril disorganized, abnormal	WT + MO2-klhl41b	standard conditions	Fig. 4 from Gupta et al., 2013
thigmotaxis disrupted, abnormal	WT + MO2-klhl41b	standard conditions	Fig. SMovie4 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal	WT + MO2-klhl41b	standard conditions	Fig. S7 from Gupta et al., 2013
skeletal muscle refractivity, abnormal	WT + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
skeletal muscle Z disc increased thickness, abnormal	WT + MO2-klhl41b	standard conditions	Fig. 4 from Gupta et al., 2013
whole organism dead, abnormal	WT + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
skeletal muscle decreased size, abnormal	WT + MO2-klhl41b	standard conditions	Fig. 4 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal	AB + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
whole organism swimming behavior decreased process quality, abnormal	AB + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
muscle cell immature, abnormal	AB + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
skeletal muscle disorganized, abnormal	AB + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere immature, abnormal	AB + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere decreased length, abnormal	AB + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
pericardium edematous, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
skeletal muscle sarcomere absent, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 4 from Gupta et al., 2013
trunk curved, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
skeletal muscle sarcomere disorganized, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. S7 from Gupta et al., 2013
whole organism dead, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
skeletal muscle myofibril disorganized, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 4 from Gupta et al., 2013
whole organism decreased size, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
skeletal muscle decreased size, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 4 from Gupta et al., 2013
eye decreased size, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. 3 from Gupta et al., 2013
thigmotaxis disrupted, abnormal	WT + MO2-klhl41a + MO2-klhl41b	standard conditions	Fig. SMovie4 from Gupta et al., 2013
skeletal muscle sarcomere length, ameliorated	AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
muscle cell maturity, ameliorated	AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere organization quality, ameliorated	AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
whole organism swimming behavior process quality, ameliorated	AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019
skeletal muscle sarcomere decreased length, abnormal	AB + MO1-nrap + MO2-klhl41a + MO2-klhl41b	control	Fig. 5 from Jirka et al., 2019

Citations