header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-140205-4
Morpholino Name: MO1-mir19
Targets: mir19a (1), mir19c (1), mir19d (1)
Previous Name: miR-19 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCAGTTTTGCATGGGTTTGCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mir19 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mir19
Expressed Gene Anatomy Figures
cyp26a1 Fig. 3Fig. S1 from Franzosa et al., 2013
PHENOTYPE
Phenotype resulting from MO1-mir19
No data available

Phenotype of all Fish created by or utilizing MO1-mir19
Genome Resources:
CITATIONS (1)