ZFIN ID: ZDB-MRPHLNO-140114-6
Morpholino Name: MO2-emilin3b
Target: emilin3b (1)
Previous Name: e3b MO (splice) (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAGCGTTTACTTACTTATGATGCCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-emilin3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-emilin3b
Expressed Gene Anatomy Figures
col2a1a Fig. S4 with image from Corallo et al., 2013
ptch1 Fig. 3 with image from Corallo et al., 2013
PHENOTYPE
Phenotype resulting from MO2-emilin3b
No data available

Phenotype of all Fish created by or utilizing MO2-emilin3b
Phenotype Fish Conditions Figures
notochord extracellular matrix decreased thickness, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with image from Corallo et al., 2013
trunk muscle pioneer increased amount, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 2 with imageFig. 4 with image from Corallo et al., 2013
notochord extracellular matrix disorganized, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with image from Corallo et al., 2013
somite shape, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with imageFig. S1 with image from Corallo et al., 2013
post-vent region muscle pioneer increased amount, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 2 with image from Corallo et al., 2013
trunk fast muscle cell increased amount, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 2 with imageFig. 4 with image from Corallo et al., 2013
smoothened signaling pathway increased process quality, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 2 with image from Corallo et al., 2013
notochord deformed, abnormal WT + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with imageFig. S1 with image from Corallo et al., 2013
somite shape, abnormal WT + MO2-emilin3a + MO2-emilin3b + MO4-tp53 standard conditions Fig. S1 with image from Corallo et al., 2013
notochord deformed, abnormal WT + MO2-emilin3a + MO2-emilin3b + MO4-tp53 standard conditions Fig. S1 with image from Corallo et al., 2013
somite shape, abnormal WT + MO2-col2a1a + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with image from Corallo et al., 2013
whole organism curved ventral, abnormal WT + MO2-col2a1a + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with image from Corallo et al., 2013
notochord deformed, abnormal WT + MO2-col2a1a + MO2-emilin3a + MO2-emilin3b standard conditions Fig. 1 with image from Corallo et al., 2013
Genome Resources:
CITATIONS (1)