header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-131219-5
Morpholino Name: MO2-sfxn4
Target: sfxn4 (1)
Sequence:
5' - ACACAGAGTCAAGGAAGTACCTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-sfxn4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-sfxn4 No data available
PHENOTYPE
Phenotype resulting from MO2-sfxn4
Phenotype of all Fish created by or utilizing MO2-sfxn4
OTHER MO2-sfxn4 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)