ZFIN ID: ZDB-MRPHLNO-131122-1
Morpholino Name: MO1-dhx37
Target: dhx37 (1)
Previous Name: Dhx37 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTTTCTTTCTCAATCTGCCCATGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dhx37 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dhx37 No data available
PHENOTYPE
Phenotype resulting from MO1-dhx37
Phenotype Figures
mechanosensory behavior process quality, abnormal text only from Hirata et al., 2013
thigmotaxis process quality, abnormal text only from Hirata et al., 2013

Phenotype of all Fish created by or utilizing MO1-dhx37
Phenotype Fish Conditions Figures
thigmotaxis process quality, abnormal WT + MO1-dhx37 standard conditions text only from Hirata et al., 2013
mechanosensory behavior process quality, abnormal WT + MO1-dhx37 standard conditions text only from Hirata et al., 2013
OTHER MO1-dhx37 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)