Morpholino

MO5-appb

ID

ZDB-MRPHLNO-131025-3

Name

MO5-appb

Previous Names

None

Target

appb (1)

Sequence

5' - CTCTTTTCTCTCTCATTACCTCTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-appb

Expressed Gene	Anatomy	Figures
appb	whole organism	Fig. 1 from Abramsson et al., 2013
dla	hindbrain	Fig. 4 from Banote et al., 2016
dld	hindbrain	Fig. 4 from Banote et al., 2016
egr2b	rhombomere 3 rhombomere 5	Fig. 8 from Banote et al., 2016
fgf3	rhombomere 4	Fig. 8 from Banote et al., 2016
her6	hindbrain	Fig. 5 from Banote et al., 2016
hoxb1a	rhombomere 4	Fig. 8 from Banote et al., 2016
neurog1	hindbrain	Fig. 4 from Banote et al., 2016
notch1a	hindbrain	Fig. 5 from Banote et al., 2016
notch1b	hindbrain	Fig. 5 from Banote et al., 2016

Phenotype

Phenotype resulting from MO5-appb

Phenotype	Fish	Figures
hindbrain neurog1 expression decreased amount, abnormal	WT + MO5-appb	Fig. 4 from Banote et al., 2016
hindbrain dld expression decreased amount, abnormal	WT + MO5-appb	Fig. 4 from Banote et al., 2016
hindbrain dla expression decreased amount, abnormal	WT + MO5-appb	Fig. 4 from Banote et al., 2016
hindbrain notch1a expression increased amount, abnormal	WT + MO5-appb	Fig. 5 from Banote et al., 2016
hindbrain her6 expression increased amount, abnormal	WT + MO5-appb	Fig. 5 from Banote et al., 2016
hindbrain lacks parts or has fewer parts of type Mauthner neuron, abnormal	WT + MO5-appb	Fig. 2 , Fig. 7 from Banote et al., 2016
hindbrain cell proliferation in hindbrain decreased occurrence, abnormal	WT + MO5-appb	Fig. 6 from Banote et al., 2016
hindbrain neuron differentiation decreased occurrence, abnormal	WT + MO5-appb	Fig. 2 , Fig. 4 from Banote et al., 2016
hindbrain Notch signaling pathway increased occurrence, abnormal	WT + MO5-appb	Fig. 5 from Banote et al., 2016
larval locomotory behavior increased rate, abnormal	AB + MO5-appb	Fig. 3 from Abramsson et al., 2013
notochord undulate, abnormal	AB + MO5-appb	Fig. 1 from Abramsson et al., 2013
notochord cell circular, abnormal	AB + MO5-appb	Fig. 1 from Abramsson et al., 2013
primary motor neuron axon increased branchiness, abnormal	AB + MO5-appb	Fig. 8 from Abramsson et al., 2013
rhombomere 3 decreased length, abnormal	WT + MO5-appb	Fig. 8 from Banote et al., 2016
rhombomere 3 morphogenesis process quality, abnormal	WT + MO5-appb	Fig. 8 from Banote et al., 2016
rhombomere 4 decreased length, abnormal	WT + MO5-appb	Fig. 8 from Banote et al., 2016
rhombomere 4 morphogenesis process quality, abnormal	WT + MO5-appb	Fig. 8 from Banote et al., 2016
secondary motor neuron axon extension decreased process quality, abnormal	rw0Tg + MO5-appb (AB)	Fig. 6 from Abramsson et al., 2013
synapse assembly disrupted, abnormal	AB + MO5-appb	Fig. 8 from Abramsson et al., 2013
thigmotaxis decreased occurrence, abnormal	WT + MO5-appb	Fig. 3 from Banote et al., 2016

Phenotype of all Fish created by or utilizing MO5-appb

Phenotype	Fish	Conditions	Figures
notochord cell circular, abnormal	AB + MO5-appb	standard conditions	Fig. 1 from Abramsson et al., 2013
primary motor neuron axon increased branchiness, abnormal	AB + MO5-appb	standard conditions	Fig. 8 from Abramsson et al., 2013
notochord undulate, abnormal	AB + MO5-appb	standard conditions	Fig. 1 from Abramsson et al., 2013
synapse assembly disrupted, abnormal	AB + MO5-appb	standard conditions	Fig. 8 from Abramsson et al., 2013
larval locomotory behavior increased rate, abnormal	AB + MO5-appb	standard conditions	Fig. 3 from Abramsson et al., 2013
hindbrain neurog1 expression decreased amount, abnormal	WT + MO5-appb	standard conditions	Fig. 4 from Banote et al., 2016
hindbrain her6 expression increased amount, abnormal	WT + MO5-appb	standard conditions	Fig. 5 from Banote et al., 2016
hindbrain notch1a expression increased amount, abnormal	WT + MO5-appb	standard conditions	Fig. 5 from Banote et al., 2016
hindbrain cell proliferation in hindbrain decreased occurrence, abnormal	WT + MO5-appb	standard conditions	Fig. 6 from Banote et al., 2016
hindbrain dld expression decreased amount, abnormal	WT + MO5-appb	standard conditions	Fig. 4 from Banote et al., 2016
rhombomere 3 morphogenesis process quality, abnormal	WT + MO5-appb	standard conditions	Fig. 8 from Banote et al., 2016
hindbrain Notch signaling pathway increased occurrence, abnormal	WT + MO5-appb	standard conditions	Fig. 5 from Banote et al., 2016
hindbrain lacks parts or has fewer parts of type Mauthner neuron, abnormal	WT + MO5-appb	standard conditions	Fig. 2 , Fig. 7 from Banote et al., 2016
hindbrain dla expression decreased amount, abnormal	WT + MO5-appb	standard conditions	Fig. 4 from Banote et al., 2016
hindbrain has number of Mauthner neuron, ameliorated	WT + MO5-appb	chemical treatment by environment: DAPT	Fig. 7 from Banote et al., 2016
thigmotaxis decreased occurrence, abnormal	WT + MO5-appb	standard conditions	Fig. 3 from Banote et al., 2016
hindbrain neuron differentiation decreased occurrence, abnormal	WT + MO5-appb	control	Fig. 2 , Fig. 4 from Banote et al., 2016
rhombomere 3 decreased length, abnormal	WT + MO5-appb	standard conditions	Fig. 8 from Banote et al., 2016
rhombomere 4 morphogenesis process quality, abnormal	WT + MO5-appb	standard conditions	Fig. 8 from Banote et al., 2016
rhombomere 4 decreased length, abnormal	WT + MO5-appb	standard conditions	Fig. 8 from Banote et al., 2016
secondary motor neuron axon extension decreased process quality, abnormal	rw0Tg + MO5-appb (AB)	standard conditions	Fig. 6 from Abramsson et al., 2013
hindbrain has number of Mauthner neuron, ameliorated	WT + MO3-notch1a + MO4-notch1a + MO5-appb	standard conditions	Fig. 7 from Banote et al., 2016

Citations