Morpholino

MO1-marcksa

ID
ZDB-MRPHLNO-131003-1
Name
MO1-marcksa
Previous Names
  • MAT (1)
Target
Sequence
5' - CTGTTTTTGTGAATTGCGCTCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-marcksa
No data available
Phenotype
Phenotype resulting from MO1-marcksa
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-marcksa Fig. 3,  Fig. 4,  Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa Fig. 3,  Fig. 4,  Fig. 6 from Ott et al., 2011
eye decreased size, abnormal WT + MO1-marcksa Fig. 7 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa Fig. 3,  Fig. 4,  Fig. 6,  Fig. 7 from Ott et al., 2011
gill filament malformed, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
gill filament chondrocyte absent, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
gill filament epithelium disorganized, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa Fig. 6 from Ott et al., 2011
post-vent region decreased length, abnormal WT + MO1-marcksa Fig. 3,  Fig. 4 from Ott et al., 2011
respiratory system development disrupted, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
retina layer formation disrupted, abnormal WT + MO1-marcksa Fig. 7 from Ott et al., 2011
retinal neural layer absent, abnormal WT + MO1-marcksa Fig. 7 from Ott et al., 2011
skeletal muscle cell curved, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased amount, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased diameter, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
skeletal muscle cell differentiation disrupted, abnormal WT + MO1-marcksa Fig. 8 from Ott et al., 2011
whole organism curved, abnormal WT + MO1-marcksa Fig. 3,  Fig. 4 from Ott et al., 2011
whole organism dead, abnormal WT + MO1-marcksa Fig. 4 from Ott et al., 2011
Phenotype of all Fish created by or utilizing MO1-marcksa
Phenotype Fish Conditions Figures
gill filament epithelium disorganized, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell curved, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased diameter, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
gill filament chondrocyte absent, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 3,  Fig. 4,  Fig. 6 from Ott et al., 2011
respiratory system development disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell differentiation disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
skeletal muscle cell nucleus increased amount, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa standard conditions Fig. 3,  Fig. 4,  Fig. 6,  Fig. 7 from Ott et al., 2011
whole organism dead, abnormal WT + MO1-marcksa standard conditions Fig. 4 from Ott et al., 2011
retina layer formation disrupted, abnormal WT + MO1-marcksa standard conditions Fig. 7 from Ott et al., 2011
post-vent region decreased length, abnormal WT + MO1-marcksa standard conditions Fig. 3,  Fig. 4 from Ott et al., 2011
whole organism curved, abnormal WT + MO1-marcksa standard conditions Fig. 3,  Fig. 4 from Ott et al., 2011
gill filament malformed, abnormal WT + MO1-marcksa standard conditions Fig. 8 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksa standard conditions Fig. 3,  Fig. 4,  Fig. 6 from Ott et al., 2011
retinal neural layer absent, abnormal WT + MO1-marcksa standard conditions Fig. 7 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa standard conditions Fig. 6 from Ott et al., 2011
eye decreased size, abnormal WT + MO1-marcksa standard conditions Fig. 7 from Ott et al., 2011
eye morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
post-vent region curved, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain morphology, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
brain development disrupted, abnormal WT + MO1-marcksa + MO4-tp53 standard conditions Fig. 6 from Ott et al., 2011
whole organism ventral region szl expression decreased amount, abnormal marcksbihb199/ihb199 + MO1-marcksa + MO1-marcksl1a + MO2-marcksl1b standard conditions Fig 7 with image from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal marcksbihb199/ihb199 + MO1-marcksa + MO1-marcksl1a + MO2-marcksl1b standard conditions Fig 7 with image from Ye et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.