Morpholino

MO3-insm1a

ID

ZDB-MRPHLNO-130920-4

Name

MO3-insm1a

Previous Names

MO1 (1)

Target

insm1a (1)

Sequence

5' - GGTTGAAATCAGAGGCACACCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO, targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-insm1a

Expressed Gene	Anatomy	Figures
atoh7	retina	Fig. 7 from Forbes-Osborne et al., 2013
crx	retina retinal outer nuclear layer whole organism	Fig. 8 from Forbes-Osborne et al., 2013
neurod1	retinal inner nuclear layer retinal outer nuclear layer	Fig. 7 from Forbes-Osborne et al., 2013
nr2e3	retina retinal outer nuclear layer whole organism	Fig. 8 from Forbes-Osborne et al., 2013

Phenotype

Phenotype resulting from MO3-insm1a

Phenotype	Fish	Figures
cell cycle process temporally extended, abnormal	WT + MO3-insm1a	Fig. 6 from Forbes-Osborne et al., 2013
eye decreased size, abnormal	WT + MO3-insm1a	Fig. 2 from Forbes-Osborne et al., 2013
horizontal cell immature, abnormal	WT + MO3-insm1a	Fig. 5 from Forbes-Osborne et al., 2013
neuron maturation delayed, abnormal	WT + MO3-insm1a	Fig. 5 from Forbes-Osborne et al., 2013
retinal bipolar neuron decreased amount, abnormal	WT + MO3-insm1a	Fig. 4 , Fig. 5 from Forbes-Osborne et al., 2013
retinal bipolar neuron immature, abnormal	WT + MO3-insm1a	Fig. 5 from Forbes-Osborne et al., 2013
retinal cone cell decreased amount, abnormal	WT + MO3-insm1a	Fig. 3 from Forbes-Osborne et al., 2013
retinal cone cell differentiation disrupted, abnormal	WT + MO3-insm1a	Fig. 3 from Forbes-Osborne et al., 2013
retinal ganglion cell decreased amount, abnormal	WT + MO3-insm1a	Fig. 4 from Forbes-Osborne et al., 2013
retinal outer plexiform layer structure, abnormal	WT + MO3-insm1a	Fig. 5 from Forbes-Osborne et al., 2013
retinal rod cell decreased amount, abnormal	WT + MO3-insm1a	Fig. 3 from Forbes-Osborne et al., 2013
retinal rod cell differentiation disrupted, abnormal	WT + MO3-insm1a	Fig. 3 from Forbes-Osborne et al., 2013

Phenotype of all Fish created by or utilizing MO3-insm1a

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	WT + MO3-insm1a	standard conditions	Fig. 2 from Forbes-Osborne et al., 2013
retinal cone cell differentiation disrupted, abnormal	WT + MO3-insm1a	standard conditions	Fig. 3 from Forbes-Osborne et al., 2013
cell cycle process temporally extended, abnormal	WT + MO3-insm1a	standard conditions	Fig. 6 from Forbes-Osborne et al., 2013
retinal cone cell decreased amount, abnormal	WT + MO3-insm1a	standard conditions	Fig. 3 from Forbes-Osborne et al., 2013
retinal bipolar neuron immature, abnormal	WT + MO3-insm1a	standard conditions	Fig. 5 from Forbes-Osborne et al., 2013
neuron maturation delayed, abnormal	WT + MO3-insm1a	standard conditions	Fig. 5 from Forbes-Osborne et al., 2013
retinal bipolar neuron decreased amount, abnormal	WT + MO3-insm1a	standard conditions	Fig. 5 from Forbes-Osborne et al., 2013
retinal ganglion cell decreased amount, abnormal	WT + MO3-insm1a	standard conditions	Fig. 4 from Forbes-Osborne et al., 2013
retinal outer plexiform layer structure, abnormal	WT + MO3-insm1a	standard conditions	Fig. 5 from Forbes-Osborne et al., 2013
retinal rod cell differentiation disrupted, abnormal	WT + MO3-insm1a	standard conditions	Fig. 3 from Forbes-Osborne et al., 2013
retinal rod cell decreased amount, abnormal	WT + MO3-insm1a	standard conditions	Fig. 3 from Forbes-Osborne et al., 2013
horizontal cell immature, abnormal	WT + MO3-insm1a	standard conditions	Fig. 5 from Forbes-Osborne et al., 2013
retinal bipolar neuron decreased amount, abnormal	q16aTg; q16bTg + MO3-insm1a	standard conditions	Fig. 4 from Forbes-Osborne et al., 2013

Citations