ZFIN ID: ZDB-MRPHLNO-130910-4
Morpholino Name: MO3-th2
Target: th2 (1)
Sequence:
5' - GCAGTCACAAAATCACCTACTCTTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-th2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-th2
Expressed Gene Anatomy Figures
th2 Fig. 3 from Ren et al., 2013
PHENOTYPE
Phenotype resulting from MO3-th2
No data available

Phenotype of all Fish created by or utilizing MO3-th2
No data available
OTHER MO3-th2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)