ZFIN ID: ZDB-MRPHLNO-130820-9
Morpholino Name: MO3-phox2bb
Target: phox2bb (1)
Previous Name: P2BT2 splice donor (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAGTAAGCGGAGAATGTCCCACCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-phox2bb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-phox2bb
Expressed Gene Anatomy Figures
ascl1a Fig. 5 with image from Pei et al., 2013
dbh Fig. 2 with imageFig. 3 with imageFig. 6 with image from Pei et al., 2013
elavl3 Fig. 6 with image from Pei et al., 2013
phox2a Fig. 5 with image from Pei et al., 2013
phox2bb Fig. 5 with imageFig. 6 with image from Pei et al., 2013
th Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 6 with image from Pei et al., 2013
PHENOTYPE
Phenotype resulting from MO3-phox2bb
Phenotype of all Fish created by or utilizing MO3-phox2bb
Genome Resources:
CITATIONS (1)