ZFIN ID: ZDB-MRPHLNO-130807-1
Morpholino Name: MO2-cacna1c
Target: cacna1c (1)
Previous Name: splice-site donor of exon 4 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGATCTTGCACTCACCTACGACCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-cacna1c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-cacna1c No data available
PHENOTYPE
Phenotype resulting from MO2-cacna1c
No data available

Phenotype of all Fish created by or utilizing MO2-cacna1c
Phenotype Fish Conditions Figures
mandibular arch skeleton morphology, abnormal WT + MO1-cacna1c + MO2-cacna1c standard conditions Fig. 3 from Ramachandran et al., 2013
Meckel's cartilage chondrocyte decreased size, abnormal WT + MO1-cacna1c + MO2-cacna1c standard conditions Fig. 4 from Ramachandran et al., 2013
heart contraction disrupted, abnormal WT + MO1-cacna1c + MO2-cacna1c standard conditions Fig. S Video1 from Ramachandran et al., 2013
ventral mandibular arch decreased size, abnormal WT + MO1-cacna1c + MO2-cacna1c standard conditions Fig. 3 from Ramachandran et al., 2013
cell population proliferation decreased occurrence, abnormal ba2Tg + MO1-cacna1c + MO2-cacna1c standard conditions Fig. 4 from Ramachandran et al., 2013
OTHER MO2-cacna1c MORPHOLINO PAGESNo links to external sites
CITATIONS (1)