header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130710-3
Morpholino Name: MO1-sfrp5
Target: sfrp5 (1)
Previous Name: exon 1 intron 1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTGCAGGTCCTACCTGGAGTCTGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sfrp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sfrp5
Expressed Gene Anatomy Figures
anxa2b Fig. 7 with image from Stuckenholz et al., 2013
fabp10a Fig. 7 with image from Stuckenholz et al., 2013
foxa1 Fig. 6 with image from Stuckenholz et al., 2013
hhex Fig. 5 with image from Stuckenholz et al., 2013
ins Fig. 7 with image from Stuckenholz et al., 2013
prss1 Fig. 7 with image from Stuckenholz et al., 2013
PHENOTYPE
Phenotype resulting from MO1-sfrp5
Phenotype of all Fish created by or utilizing MO1-sfrp5
OTHER MO1-sfrp5 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)