Morpholino

MO3-pacsin1b

ID

ZDB-MRPHLNO-130531-3

Name

MO3-pacsin1b

Previous Names

Target

Sequence

5' - GTCAAAATCCTTCCTCACCTCTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO. The author was contacted and provided this corrected sequence.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-pacsin1b

Expressed Gene	Anatomy	Figures
eya1	neuromast	Fig. 4 from Schuler et al., 2013
pacsin1b	whole organism	Fig. 2 from Schuler et al., 2013

Phenotype

Phenotype resulting from MO3-pacsin1b

Phenotype	Fish	Figures
axis decreased length, abnormal	AB + MO3-pacsin1b	Fig. 2 from Schuler et al., 2013
brain edematous, abnormal	AB + MO3-pacsin1b	Fig. 2 from Schuler et al., 2013
eye decreased size, abnormal	AB + MO3-pacsin1b	Fig. 2 from Schuler et al., 2013
head decreased size, abnormal	AB + MO3-pacsin1b	Fig. 2 from Schuler et al., 2013
heart edematous, abnormal	AB + MO3-pacsin1b	Fig. 2 from Schuler et al., 2013
posterior lateral line neuromast decreased amount, abnormal	AB + MO3-pacsin1b	Fig. 4 from Schuler et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast kinocilium, abnormal	AB + MO3-pacsin1b	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast kinocilium decreased length, abnormal	AB + MO3-pacsin1b	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast stereocilium decreased length, abnormal	AB + MO3-pacsin1b	Fig. 6 from Schuler et al., 2013
whole organism increased curvature, abnormal	AB + MO3-pacsin1b	Fig. 2 from Schuler et al., 2013

Phenotype of all Fish created by or utilizing MO3-pacsin1b

Phenotype	Fish	Conditions	Figures
heart edematous, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
eye decreased size, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
whole organism increased curvature, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
posterior lateral line neuromast stereocilium decreased length, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 6 from Schuler et al., 2013
head decreased size, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
brain edematous, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
axis decreased length, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 2 from Schuler et al., 2013
posterior lateral line neuromast kinocilium decreased length, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast has fewer parts of type neuromast kinocilium, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 6 from Schuler et al., 2013
posterior lateral line neuromast decreased amount, abnormal	AB + MO3-pacsin1b	standard conditions	Fig. 4 from Schuler et al., 2013

Citations