ZFIN ID: ZDB-MRPHLNO-130509-3
Morpholino Name: MO1-hoxd4a
Target: hoxd4a (1)
Previous Name: MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTTCACTGTGAAGGACAAAATCACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hoxd4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hoxd4a
Expressed Gene Anatomy Figures
cdx4 Fig. 9 with imageFig. 10 with image from Amali et al., 2013
efnb2a Fig. 5 with image from Amali et al., 2013
ephb4a Fig. 5 with image from Amali et al., 2013
fli1a Fig. 5 with imageFig. 8 with image from Amali et al., 2013
gata1a Fig. 2 with imageFig. 3 with imageFig. 8 with image from Amali et al., 2013
hbbe1.1 Fig. 2 with imageFig. 3 with image from Amali et al., 2013
hoxa9a Fig. 10 with image from Amali et al., 2013
hoxa10b Fig. 10 with image from Amali et al., 2013
hoxb1a Fig. 10 with image from Amali et al., 2013
hoxb3a Fig. 10 with image from Amali et al., 2013
hoxb4a Fig. 10 with image from Amali et al., 2013
hoxb5a Fig. 10 with image from Amali et al., 2013
hoxb6b Fig. 10 with image from Amali et al., 2013
hoxb7a Fig. 10 with image from Amali et al., 2013
hoxb8a Fig. 10 with image from Amali et al., 2013
hoxc4a Fig. 10 with image from Amali et al., 2013
hoxc5a Fig. 10 with image from Amali et al., 2013
hoxc6a Fig. 10 with image from Amali et al., 2013
hoxc8a Fig. 10 with image from Amali et al., 2013
hoxc9a Fig. 10 with image from Amali et al., 2013
hoxd3a Fig. 10 with image from Amali et al., 2013
hoxd4a Fig. 9 with image from Amali et al., 2013
hoxd10a Fig. 10 with image from Amali et al., 2013
kdr Fig. 5 with image from Amali et al., 2013
lmo2 Fig. 5 with imageFig. 6 with image from Amali et al., 2013
meis1b Fig. 8 with imageFig. 9 with imageFig. 10 with image from Amali et al., 2013
myb Fig. 3 with image from Amali et al., 2013
runx1 Fig. 3 with image from Amali et al., 2013
tal1 Fig. 5 with imageFig. 6 with imageFig. 8 with image from Amali et al., 2013
vegfaa Fig. 5 with image from Amali et al., 2013
PHENOTYPE
Phenotype resulting from MO1-hoxd4a
Phenotype Figures
angiogenesis disrupted, abnormal Fig. 4 with image from Amali et al., 2013
caudal vein plexus aplastic, abnormal Fig. 4 with image from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal Fig. 3 with image from Amali et al., 2013
primitive hemopoiesis disrupted, abnormal Fig. 2 with imageFig. 3 with image from Amali et al., 2013
subintestinal vein aplastic, abnormal Fig. 4 with image from Amali et al., 2013
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal Fig. 4 with image from Amali et al., 2013
vasculogenesis disrupted, abnormal Fig. 4 with image from Amali et al., 2013
vertebral artery aplastic, abnormal Fig. 4 with image from Amali et al., 2013

Phenotype of all Fish created by or utilizing MO1-hoxd4a
Phenotype Fish Conditions Figures
vertebral artery aplastic, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
primitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a standard conditions Fig. 2 with imageFig. 3 with image from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a standard conditions Fig. 3 with image from Amali et al., 2013
subintestinal vein aplastic, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
caudal vein plexus aplastic, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
vasculogenesis disrupted, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
angiogenesis disrupted, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
OTHER MO1-hoxd4a MORPHOLINO PAGESNo links to external sites
CITATIONS (1)