ZFIN ID: ZDB-MRPHLNO-130501-1
Morpholino Name: MO1-prlra
Target: prlra (1)
Sequence:
5' - TCAGCACAGCGGCGGAAATCCTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-prlra No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-prlra
Expressed Gene Anatomy Figures
prl Fig. 4 from Liu et al., 2006
PHENOTYPE
Phenotype resulting from MO1-prlra
Phenotype Figures
eye decreased size, abnormal Fig. 4 from Liu et al., 2006
head decreased size, abnormal Fig. 4 from Liu et al., 2006

Phenotype of all Fish created by or utilizing MO1-prlra
Phenotype Fish Conditions Figures
head decreased size, abnormal zf113Tg; zf44Tg + MO1-prlra standard conditions Fig. 4 from Liu et al., 2006
eye decreased size, abnormal zf113Tg; zf44Tg + MO1-prlra standard conditions Fig. 4 from Liu et al., 2006
OTHER MO1-prlra MORPHOLINO PAGESNo links to external sites
CITATIONS (1)