header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130417-2
Morpholino Name: MO2-opa1
Target: opa1 (1)
Sequence:
5' - ACAGTCTGCGAAAAGAAGTCAATCA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-opa1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-opa1 No data available
PHENOTYPE
Phenotype resulting from MO2-opa1
Phenotype of all Fish created by or utilizing MO2-opa1
OTHER MO2-opa1 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)