header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130417-1
Morpholino Name: MO1-opa1
Target: opa1 (1)
Sequence:
5' - GATGAGTTTAGGATCTCTTTGCAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-opa1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-opa1
Expressed Gene Anatomy Figures
dnm1l Fig. 5 with image from Rahn et al., 2013
mfn1b Fig. 5 with image from Rahn et al., 2013
mfn2 Fig. 5 with image from Rahn et al., 2013
mt-nd1 Fig. 6 with image from Rahn et al., 2013
ndufb8 Fig. 6 with image from Rahn et al., 2013
opa1 Fig. 6 from Li et al., 2014
Fig. 5 with image from Rahn et al., 2013
polg Fig. 6 with image from Rahn et al., 2013
polg2 Fig. 6 with image from Rahn et al., 2013
ppargc1a Fig. 6 with image from Rahn et al., 2013
twnk Fig. 6 with image from Rahn et al., 2013
PHENOTYPE
Phenotype resulting from MO1-opa1
Phenotype Figures
blood circulation disrupted, abnormal Fig. 2 with image from Rahn et al., 2013
cardiac muscle cell increased size, abnormal Fig. 6 from Li et al., 2014
cellular respiration decreased process quality, abnormal Fig. 7 with image from Rahn et al., 2013
eye decreased size, abnormal Fig. 2 with imageFig. 3 with image from Rahn et al., 2013
eye edematous, abnormal Fig. 2 with image from Rahn et al., 2013
fourth ventricle increased size, abnormal Fig. 2 with image from Rahn et al., 2013
heart decreased size, abnormal Fig. 2 with image from Rahn et al., 2013
heart contraction decreased rate, abnormal Fig. 3 with image from Rahn et al., 2013
heart looping disrupted, abnormal Fig. 2 with image from Rahn et al., 2013
midbrain hindbrain boundary inconspicuous, abnormal Fig. 2 with image from Rahn et al., 2013
muscle contractile fiber disorganized, abnormal Fig. 4 with image from Rahn et al., 2013
muscle cell mitochondrion broken, abnormal Fig. 4 with image from Rahn et al., 2013
nucleate erythrocyte accumulation heart, abnormal Fig. 2 with image from Rahn et al., 2013
pectoral fin decreased size, abnormal Fig. 2 with image from Rahn et al., 2013
pericardium edematous, abnormal Fig. 2 with image from Rahn et al., 2013
startle response decreased process quality, abnormal Fig. SMovie 2 from Rahn et al., 2013
swimming behavior disrupted, abnormal Fig. SMovie 2 from Rahn et al., 2013
whole organism dead, abnormal text only from Rahn et al., 2013
whole organism opa1 expression decreased amount, abnormal Fig. 6 from Li et al., 2014
whole organism decreased length, abnormal Fig. 2 with image from Rahn et al., 2013
yolk edematous, abnormal Fig. 2 with image from Rahn et al., 2013
yolk increased size, abnormal Fig. 2 with image from Rahn et al., 2013

Phenotype of all Fish created by or utilizing MO1-opa1
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
fourth ventricle increased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
heart looping disrupted, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
muscle cell mitochondrion broken, abnormal AB + MO1-opa1 standard conditions Fig. 4 with image from Rahn et al., 2013
whole organism dead, abnormal AB + MO1-opa1 standard conditions text only from Rahn et al., 2013
eye decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with imageFig. 3 with image from Rahn et al., 2013
midbrain hindbrain boundary inconspicuous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
nucleate erythrocyte accumulation heart, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
heart decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
eye edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
pericardium edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
yolk edematous, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
cellular respiration decreased process quality, abnormal AB + MO1-opa1 standard conditions Fig. 7 with image from Rahn et al., 2013
heart contraction decreased rate, abnormal AB + MO1-opa1 standard conditions Fig. 3 with image from Rahn et al., 2013
startle response decreased process quality, abnormal AB + MO1-opa1 standard conditions Fig. SMovie 2 from Rahn et al., 2013
blood circulation disrupted, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
muscle contractile fiber disorganized, abnormal AB + MO1-opa1 standard conditions Fig. 4 with image from Rahn et al., 2013
pectoral fin decreased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
yolk increased size, abnormal AB + MO1-opa1 standard conditions Fig. 2 with image from Rahn et al., 2013
swimming behavior disrupted, abnormal AB + MO1-opa1 standard conditions Fig. SMovie 2 from Rahn et al., 2013
whole organism opa1 expression decreased amount, abnormal WT + MO1-opa1 standard conditions Fig. 6 from Li et al., 2014
cardiac muscle cell increased size, abnormal WT + MO1-opa1 standard conditions Fig. 6 from Li et al., 2014
OTHER MO1-opa1 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)