Morpholino

MO2-rer1

ID
ZDB-MRPHLNO-130412-2
Name
MO2-rer1
Previous Names
  • SMO (1)
Target
Sequence
5' - CCACCCCTAATACAAACAAACAAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rer1
Phenotype
Phenotype resulting from MO2-rer1
Phenotype Fish Figures
anterior lateral line neuromast cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
cilium assembly disrupted, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
detection of light stimulus involved in visual perception decreased process quality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased size, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
fluid transport disrupted, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
heart looping process quality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium movement quality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
macula cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
neuromast decreased amount, abnormal AB + MO2-rer1 Fig. 5 from Jurisch-Yaksi et al., 2013
olfactory pit cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
optokinetic behavior disrupted, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage morphology, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage chondrocyte decreased amount, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
posterior lateral line neuromast hair cell decreased amount, abnormal sqet4Et + MO2-rer1 Fig. 5 from Jurisch-Yaksi et al., 2013
pronephros cilium decreased length, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
retina decreased functionality, abnormal AB + MO2-rer1 Fig. 2 from Jurisch-Yaksi et al., 2013
retinal cone cell decreased amount, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
retinal rod cell decreased amount, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal AB + MO2-rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
Phenotype of all Fish created by or utilizing MO2-rer1
Phenotype Fish Conditions Figures
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
cilium assembly disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
optokinetic behavior disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased size, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
retinal cone cell decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
neuromast decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 5 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
anterior lateral line neuromast cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium movement quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
macula cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
heart looping process quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage morphology, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
retina decreased functionality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage chondrocyte decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
fluid transport disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
retinal rod cell decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
olfactory pit cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
pronephros cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
detection of light stimulus involved in visual perception decreased process quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
posterior lateral line neuromast hair cell decreased amount, abnormal sqet4Et + MO2-rer1 standard conditions Fig. 5 from Jurisch-Yaksi et al., 2013
Citations