header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130412-2
Morpholino Name: MO2-rer1
Target: rer1 (1)
Previous Name: SMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCACCCCTAATACAAACAAACAAAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-rer1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-rer1
Expressed Gene Anatomy Figures
dla Fig. 5 from Jurisch-Yaksi et al., 2013
dnah9 Fig. 5 from Jurisch-Yaksi et al., 2013
foxj1a Fig. 5 from Jurisch-Yaksi et al., 2013
notch1a Fig. 5 from Jurisch-Yaksi et al., 2013
notch3 Fig. 5 from Jurisch-Yaksi et al., 2013
rer1 Fig. 1 from Jurisch-Yaksi et al., 2013
PHENOTYPE
Phenotype resulting from MO2-rer1
Phenotype Figures
anterior lateral line neuromast cilium decreased length, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
cilium assembly disrupted, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
detection of light stimulus involved in visual perception decreased process quality, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased size, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
fluid transport disrupted, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
heart looping process quality, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium movement quality, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
macula cilium decreased length, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
neuromast decreased amount, abnormal Fig. 5 from Jurisch-Yaksi et al., 2013
olfactory pit cilium decreased length, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
optokinetic behavior disrupted, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage morphology, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage chondrocyte decreased amount, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
posterior lateral line neuromast hair cell decreased amount, abnormal Fig. 5 from Jurisch-Yaksi et al., 2013
pronephros cilium decreased length, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
retina decreased functionality, abnormal Fig. 2 from Jurisch-Yaksi et al., 2013
retinal cone cell decreased amount, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
retinal rod cell decreased amount, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal Fig. 1 from Jurisch-Yaksi et al., 2013

Phenotype of all Fish created by or utilizing MO2-rer1
Phenotype Fish Conditions Figures
eye photoreceptor cell photoreceptor outer segment decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
cilium assembly disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
optokinetic behavior disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
whole organism anterior-posterior axis bent, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
eye photoreceptor cell photoreceptor outer segment decreased size, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
retinal cone cell decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
neuromast decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 5 from Jurisch-Yaksi et al., 2013
post-vent region curved ventral, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
anterior lateral line neuromast cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium movement quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
macula cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
heart looping process quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage morphology, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
retina decreased functionality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
pharyngeal arch cartilage chondrocyte decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
fluid transport disrupted, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
retinal rod cell decreased amount, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
olfactory pit cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
pronephros cilium decreased length, abnormal AB + MO2-rer1 standard conditions Fig. 1 from Jurisch-Yaksi et al., 2013
detection of light stimulus involved in visual perception decreased process quality, abnormal AB + MO2-rer1 standard conditions Fig. 2 from Jurisch-Yaksi et al., 2013
posterior lateral line neuromast hair cell decreased amount, abnormal sqet4Et + MO2-rer1 standard conditions Fig. 5 from Jurisch-Yaksi et al., 2013
Genome Resources:
CITATIONS (1)