Morpholino

MO1-dnm2b

ID

ZDB-MRPHLNO-130411-2

Name

MO1-dnm2b

Previous Names

None

Target

dnm2b (1)

Sequence

5' - CAACCCCACTGCTCTCACCGGATCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dnm2b

No data available

Phenotype

Phenotype resulting from MO1-dnm2b

Phenotype	Fish	Figures
eye decreased size, abnormal	AB + MO1-dnm2b	Fig. 2 from Gibbs et al., 2013
glomerular filtration disrupted, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015
glomerular filtration process quality, abnormal	AB/TL + MO1-dnm2b	Fig. 2 from Khalil et al., 2018
muscle morphology, abnormal	AB + MO1-dnm2b	Fig. 2 from Gibbs et al., 2013
pericardium edematous, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015
pigmentation disrupted, abnormal	AB + MO1-dnm2b	Fig. 2 from Gibbs et al., 2013
post-vent region curved, abnormal	AB + MO1-dnm2b	Fig. 2 from Gibbs et al., 2013
post-vent region curved dorsal, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015
pronephric glomerulus increased permeability, abnormal	AB/TL + MO1-dnm2b	Fig. 2 from Khalil et al., 2018
pronephric glomerulus podocyte foot morphology, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015
trunk musculature myofibril decreased size, abnormal	AB + MO1-dnm2b	Fig. 4 from Gibbs et al., 2013
whole organism decreased length, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015
whole organism decreased life span, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015
whole organism anterior-posterior axis decreased thickness, abnormal	AB + MO1-dnm2b	Fig. 2 from Gibbs et al., 2013
yolk syncytial layer edematous, abnormal	AB + MO1-dnm2b	Fig. 1 from Schiffer et al., 2015

Phenotype of all Fish created by or utilizing MO1-dnm2b

Phenotype	Fish	Conditions	Figures
pigmentation disrupted, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 2 from Gibbs et al., 2013
pericardium edematous, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
post-vent region curved dorsal, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
eye decreased size, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 2 from Gibbs et al., 2013
trunk musculature myofibril decreased size, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 4 from Gibbs et al., 2013
pronephric glomerulus podocyte foot morphology, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
yolk syncytial layer edematous, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
whole organism anterior-posterior axis decreased thickness, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 2 from Gibbs et al., 2013
glomerular filtration disrupted, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
whole organism decreased life span, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
whole organism decreased length, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 1 from Schiffer et al., 2015
post-vent region curved, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 2 from Gibbs et al., 2013
muscle morphology, abnormal	AB + MO1-dnm2b	standard conditions	Fig. 2 from Gibbs et al., 2013
pronephric glomerulus increased permeability, abnormal	AB/TL + MO1-dnm2b	control	Fig. 2 from Khalil et al., 2018
glomerular filtration process quality, abnormal	AB/TL + MO1-dnm2b	control	Fig. 2 from Khalil et al., 2018

Citations