ZFIN ID: ZDB-MRPHLNO-130408-5
Morpholino Name: MO3-pak4
Target: pak4 (1)
Previous Name: Splice MO-1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GCTTTATATTCTGATTACCTGACCG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pak4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pak4 No data available
PHENOTYPE
Phenotype resulting from MO3-pak4
No data available

Phenotype of all Fish created by or utilizing MO3-pak4
Phenotype Fish Conditions Figures
myeloid leukocyte decreased amount, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. S3 with image from Law et al., 2013
cranial cartilage morphology, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
embryonic morphogenesis disrupted, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
somite malformed, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
whole organism anterior-posterior axis shortened, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
head decreased size, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
eye decreased size, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 2 with image from Law et al., 2013
myeloid cell differentiation disrupted, abnormal EKW + MO3-pak4 + MO4-pak4 + MO5-pak4 standard conditions Fig. 3 with image from Law et al., 2013
OTHER MO3-pak4 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)