header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130327-2
Morpholino Name: MO4-arxa
Target: arxa (1)
Previous Name: MoTarx (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCGTCGTCGTACTGACTGCTCATGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-arxa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-arxa
Expressed Gene Anatomy Figures
arxa Fig. 6 with image from Djiotsa et al., 2012
PHENOTYPE
Phenotype resulting from MO4-arxa
No data available

Phenotype of all Fish created by or utilizing MO4-arxa
OTHER MO4-arxa MORPHOLINO PAGES No links to external sites
CITATIONS (2)