Morpholino

MO1-dio3b

ID
ZDB-MRPHLNO-130306-3
Name
MO1-dio3b
Previous Names
None
Target
Sequence
5' - CTGCGGAGCCCTGCAGCATCTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dio3b
Expressed Gene Anatomy Figures
aldh1a2 Fig. 4 with image from Bohnsack et al., 2013
arr3a Fig. 6 with image from Houbrechts et al., 2016
cyp26c1 Fig. 4 with image from Bohnsack et al., 2013
foxa2 Fig. 5 from Heijlen et al., 2014
opn1sw1 Fig. 6 with image from Houbrechts et al., 2016
opn1sw2 Fig. 6 with image from Houbrechts et al., 2016
pitx2 Fig. 4 with image from Bohnsack et al., 2013
twist1a Fig. 4 with image from Bohnsack et al., 2013
tyr Fig. 4 with image,  Fig. S4 with image from Bohnsack et al., 2013
Phenotype
Phenotype resulting from MO1-dio3b
Phenotype Fish Figures
embryo development delayed, abnormal WIK + MO1-dio3b Fig. 3 from Heijlen et al., 2014
eye decreased area, abnormal WIK + MO1-dio3b Fig. 4 with image from Houbrechts et al., 2016
eye decreased size, abnormal WIK + MO1-dio3b Fig. 3 from Heijlen et al., 2014
hatching disrupted, abnormal WIK + MO1-dio3b Fig. 8,  text only from Heijlen et al., 2014
hindbrain cyp26c1 expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
inner ear decreased size, abnormal WIK + MO1-dio3b Fig. 3 from Heijlen et al., 2014
liver decreased size, abnormal WIK + MO1-dio3b Fig. 5 from Heijlen et al., 2014
locomotory behavior decreased occurrence, abnormal WIK + MO1-dio3b Fig. 6 from Heijlen et al., 2014
optomotor response decreased occurrence, abnormal WIK + MO1-dio3b Fig. 7 with image from Houbrechts et al., 2016
otic vesicle cyp26c1 expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme aldh1a2 expression decreased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme pitx2 expression decreased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch aldh1a2 expression decreased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 1 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 2 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3-7 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 4 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 5 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 6 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 7 twist1a expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
response to light stimulus decreased occurrence, abnormal WIK + MO1-dio3b Fig. 8 with image from Houbrechts et al., 2016
retina cyp26c1 expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
retina tyr expression increased amount, abnormal WT + MO1-dio3b Fig. S4 with image from Bohnsack et al., 2013
retina layer formation decreased process quality, abnormal WIK + MO1-dio3b Fig. 5 with image from Houbrechts et al., 2016
retinal neural layer disorganized, abnormal WIK + MO1-dio3b Fig. 5 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal cone cell, abnormal WIK + MO1-dio3b Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer UV sensitive photoreceptor cell, abnormal WIK + MO1-dio3b Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer green sensitive photoreceptor cell, abnormal WIK + MO1-dio3b Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer blue sensitive photoreceptor cell, abnormal WIK + MO1-dio3b Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal rod cell, abnormal WIK + MO1-dio3b Fig. 6 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer red sensitive photoreceptor cell, abnormal WIK + MO1-dio3b Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
swim bladder disorganized, abnormal WIK + MO1-dio3b Fig. 5 from Heijlen et al., 2014
swim bladder uninflated, abnormal WIK + MO1-dio3b Fig. 4 from Heijlen et al., 2014
swim bladder development disrupted, abnormal WT + MO1-dio3b Fig. 4 from Heijlen et al., 2013
swim bladder morphogenesis disrupted, abnormal WIK + MO1-dio3b Fig. 5 from Heijlen et al., 2014
swimming behavior disrupted, abnormal WIK + MO1-dio3b Fig. 6 from Heijlen et al., 2014
thigmotaxis disrupted, abnormal WIK + MO1-dio3b Fig. 6 from Heijlen et al., 2014
whole organism decreased length, abnormal WIK + MO1-dio3b Fig. 4 with image from Houbrechts et al., 2016
Fig. 3 from Heijlen et al., 2014
whole organism tyr expression increased amount, abnormal WT + MO1-dio3b Fig. 4 with image from Bohnsack et al., 2013
Phenotype of all Fish created by or utilizing MO1-dio3b
Phenotype Fish Conditions Figures
eye decreased area, abnormal WIK + MO1-dio3b standard conditions Fig. 4 with image from Houbrechts et al., 2016
eye decreased size, abnormal WIK + MO1-dio3b standard conditions Fig. 3 from Heijlen et al., 2014
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer blue sensitive photoreceptor cell, abnormal WIK + MO1-dio3b standard conditions Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer red sensitive photoreceptor cell, abnormal WIK + MO1-dio3b standard conditions Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal neural layer disorganized, abnormal WIK + MO1-dio3b standard conditions Fig. 5 with image from Houbrechts et al., 2016
swim bladder disorganized, abnormal WIK + MO1-dio3b standard conditions Fig. 5 from Heijlen et al., 2014
retina layer formation decreased process quality, abnormal WIK + MO1-dio3b standard conditions Fig. 5 with image from Houbrechts et al., 2016
swim bladder uninflated, abnormal WIK + MO1-dio3b standard conditions Fig. 4 from Heijlen et al., 2014
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer green sensitive photoreceptor cell, abnormal WIK + MO1-dio3b standard conditions Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
thigmotaxis disrupted, abnormal WIK + MO1-dio3b standard conditions Fig. 6 from Heijlen et al., 2014
inner ear decreased size, abnormal WIK + MO1-dio3b standard conditions Fig. 3 from Heijlen et al., 2014
locomotory behavior decreased occurrence, abnormal WIK + MO1-dio3b standard conditions Fig. 6 from Heijlen et al., 2014
whole organism decreased length, abnormal WIK + MO1-dio3b standard conditions Fig. 4 with image from Houbrechts et al., 2016
Fig. 3 from Heijlen et al., 2014
optomotor response decreased occurrence, abnormal WIK + MO1-dio3b standard conditions Fig. 7 with image from Houbrechts et al., 2016
swim bladder morphogenesis disrupted, abnormal WIK + MO1-dio3b standard conditions Fig. 5 from Heijlen et al., 2014
retinal photoreceptor layer has fewer parts of type retinal rod cell, abnormal WIK + MO1-dio3b standard conditions Fig. 6 with image from Houbrechts et al., 2016
liver decreased size, abnormal WIK + MO1-dio3b standard conditions Fig. 5 from Heijlen et al., 2014
retinal photoreceptor layer has fewer parts of type retinal cone cell, abnormal WIK + MO1-dio3b standard conditions Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
retinal photoreceptor layer has fewer parts of type retinal photoreceptor layer UV sensitive photoreceptor cell, abnormal WIK + MO1-dio3b standard conditions Fig. 6 with image,  Fig. T4 with image from Houbrechts et al., 2016
embryo development delayed, abnormal WIK + MO1-dio3b standard conditions Fig. 3 from Heijlen et al., 2014
hatching disrupted, abnormal WIK + MO1-dio3b standard conditions Fig. 8,  text only from Heijlen et al., 2014
response to light stimulus decreased occurrence, abnormal WIK + MO1-dio3b standard conditions Fig. 8 with image from Houbrechts et al., 2016
swimming behavior disrupted, abnormal WIK + MO1-dio3b standard conditions Fig. 6 from Heijlen et al., 2014
whole organism tyr expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3-7 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 7 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 6 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 5 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
hindbrain cyp26c1 expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
retina tyr expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. S4 with image from Bohnsack et al., 2013
retina cyp26c1 expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch aldh1a2 expression decreased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
otic vesicle cyp26c1 expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 2 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
swim bladder development disrupted, abnormal WT + MO1-dio3b standard conditions Fig. 4 from Heijlen et al., 2013
neural crest cell migration disrupted, abnormal WT + MO1-dio3b chemical treatment: N-phenylthiourea Fig. 1 with image from Bohnsack et al., 2013
pharyngeal arch 4 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme pitx2 expression decreased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme aldh1a2 expression decreased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 1 twist1a expression increased amount, abnormal WT + MO1-dio3b standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3-7 agenesis, abnormal mpv17a9; zf15Tg + MO1-dio3b standard conditions Fig. 2 with image from Bohnsack et al., 2013
pharyngeal arch agenesis, abnormal mpv17a9; zf15Tg + MO1-dio3b standard conditions Fig. 1 with image from Bohnsack et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.