Morpholino

MO1-agrp

ID
ZDB-MRPHLNO-130226-1
Name
MO1-agrp
Previous Names
  • agrp ATG MO (1)
Target
Sequence
5' - ACTGTGTTCAGCATCATAATCACTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-agrp
Expressed Gene Anatomy Figures
crhb Fig. 3 with image from Zhang et al., 2012
fshb Fig. 3 with image from Zhang et al., 2012
gh1 Fig. 3 with image,  Fig. S3 with image from Zhang et al., 2012
ghrh Fig. 3 with image,  Fig. S3 with image from Zhang et al., 2012
igf1 Fig. 3 with image from Zhang et al., 2012
igf3 Fig. 3 with image from Zhang et al., 2012
lhb Fig. 3 with image from Zhang et al., 2012
pmch Fig. 4 from Zhang et al., 2010
pmchl Fig. 4 from Zhang et al., 2010
pomca Fig. 3 with image,  Fig. S3 with image from Zhang et al., 2012
pou1f1 Fig. 3 with image from Zhang et al., 2012
smtla Fig. 3 with image from Zhang et al., 2012
smtlb Fig. 3 with image from Zhang et al., 2012
sst1.1 Fig. 3 with image from Zhang et al., 2012
sst2 Fig. 3 with image from Zhang et al., 2012
trh Fig. 3 with image from Zhang et al., 2012
tshba Fig. 3 with image from Zhang et al., 2012
Phenotype
Phenotype resulting from MO1-agrp
Phenotype Fish Figures
developmental growth process quality, abnormal WT + MO1-agrp Fig. 1 with image,  Fig. 2 with image from Zhang et al., 2012
hypothalamus neuron decreased amount, abnormal WT + MO1-agrp Fig. 4 from Zhang et al., 2010
metabolic process increased rate, abnormal WT + MO1-agrp Fig. 5 from Renquist et al., 2013
somite decreased size, abnormal WT + MO1-agrp Fig. 1 with image from Zhang et al., 2012
whole organism decreased length, abnormal WT + MO1-agrp Fig. 1 from Sebag et al., 2013
Fig. 1 with image,  Fig. 2 with image,  Fig. S2 with image from Zhang et al., 2012
Phenotype of all Fish created by or utilizing MO1-agrp
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal TL + MO1-agrp standard conditions Fig. 1 from Sebag et al., 2013
hypothalamus neuron decreased amount, abnormal WT + MO1-agrp standard conditions Fig. 4 from Zhang et al., 2010
somite decreased size, abnormal WT + MO1-agrp standard conditions Fig. 1 with image from Zhang et al., 2012
developmental growth process quality, abnormal WT + MO1-agrp standard conditions Fig. 1 with image,  Fig. 2 with image from Zhang et al., 2012
metabolic process increased rate, abnormal WT + MO1-agrp control Fig. 5 from Renquist et al., 2013
whole organism decreased length, abnormal WT + MO1-agrp standard conditions Fig. 1 with image,  Fig. 2 with image,  Fig. S2 with image from Zhang et al., 2012
metabolic process increased rate, abnormal mc4rsa149/sa149 + MO1-agrp control Fig. 5 from Renquist et al., 2013
whole organism decreased length, abnormal TL + MO1-agrp + MO1-mrap2a standard conditions Fig. 1 from Sebag et al., 2013
whole organism decreased length, abnormal TL + MO1-agrp + MO1-mrap2b standard conditions Fig. 1 from Sebag et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.