ZFIN ID: ZDB-MRPHLNO-130226-1
Morpholino Name: MO1-agrp
Target: agrp (1)
Previous Name: agrp ATG MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACTGTGTTCAGCATCATAATCACTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-agrp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-agrp
Expressed Gene Anatomy Figures
crhb whole organism Fig. 3 with image from Zhang et al., 2012
fshb whole organism Fig. 3 with image from Zhang et al., 2012
gh1 hypophysis, whole organism Fig. 3 with image from Zhang et al., 2012
ghrh whole organism Fig. 3 with imageFig. S3 with image from Zhang et al., 2012
igf1 whole organism Fig. 3 with image from Zhang et al., 2012
igf3 whole organism Fig. 3 with image from Zhang et al., 2012
lhb whole organism Fig. 3 with image from Zhang et al., 2012
pmch whole organism Fig. 4 from Zhang et al., 2010
pmchl whole organism Fig. 4 from Zhang et al., 2010
pomca hypophysis, whole organism Fig. 3 with image from Zhang et al., 2012
pou1f1 whole organism Fig. 3 with image from Zhang et al., 2012
smtla whole organism Fig. 3 with image from Zhang et al., 2012
smtlb whole organism Fig. 3 with image from Zhang et al., 2012
sst1.1 whole organism Fig. 3 with image from Zhang et al., 2012
sst2 whole organism Fig. 3 with image from Zhang et al., 2012
trh whole organism Fig. 3 with image from Zhang et al., 2012
tshba whole organism Fig. 3 with image from Zhang et al., 2012
PHENOTYPE 
Phenotype resulting from MO1-agrp
Phenotype Figures
developmental growth process quality, abnormal Fig. 1 with imageFig. 2 with image from Zhang et al., 2012
hypothalamus neuron decreased amount, abnormal Fig. 4 from Zhang et al., 2010
metabolic process increased rate, abnormal Fig. 5 from Renquist et al., 2013
somite decreased size, abnormal Fig. 1 with image from Zhang et al., 2012
whole organism decreased length, abnormal Fig. 1 from Sebag et al., 2013
whole organism decreased length, abnormal Fig. 1 with imageFig. 2 with imageFig. S2 with image from Zhang et al., 2012

Phenotype of all Fish created by or utilizing MO1-agrp
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal TL + MO1-agrp standard conditions Fig. 1 from Sebag et al., 2013
hypothalamus neuron decreased amount, abnormal WT + MO1-agrp standard conditions Fig. 4 from Zhang et al., 2010
somite decreased size, abnormal WT + MO1-agrp standard conditions Fig. 1 with image from Zhang et al., 2012
developmental growth process quality, abnormal WT + MO1-agrp standard conditions Fig. 1 with imageFig. 2 with image from Zhang et al., 2012
metabolic process increased rate, abnormal WT + MO1-agrp control Fig. 5 from Renquist et al., 2013
whole organism decreased length, abnormal WT + MO1-agrp standard conditions Fig. 1 with imageFig. 2 with imageFig. S2 with image from Zhang et al., 2012
metabolic process increased rate, abnormal mc4rsa149/sa149 + MO1-agrp control Fig. 5 from Renquist et al., 2013
whole organism decreased length, abnormal TL + MO1-agrp + MO1-mrap2a standard conditions Fig. 1 from Sebag et al., 2013
whole organism decreased length, abnormal TL + MO1-agrp + MO1-mrap2b standard conditions Fig. 1 from Sebag et al., 2013
OTHER MO1-agrp MORPHOLINO PAGESNo links to external sites
CITATIONS (4)