ZFIN ID: ZDB-MRPHLNO-130215-1
Morpholino Name: MO1-gpc4
Target: gpc4 (1)
Sequence:
5' - CTGTAAACACAACGATCATCTTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gpc4 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gpc4
Expressed Gene Anatomy Figures
ctslb Fig. 2 with image from Young et al., 2014
dlx3b Fig. 2 with image from Young et al., 2014
tbxta Fig. 2 with image from Young et al., 2014
PHENOTYPE
Phenotype resulting from MO1-gpc4
Phenotype of all Fish created by or utilizing MO1-gpc4
Phenotype Fish Conditions Figures
anterior neural plate increased width, abnormal WT + MO1-gpc4 standard conditions Fig. S7 from Castanon et al., 2013
convergent extension disrupted, abnormal WT + MO1-gpc4 standard conditions Fig. S7 from Castanon et al., 2013
prechordal plate elongated, abnormal WT + MO1-gpc4 standard conditions Fig. S7 from Castanon et al., 2013
notochord decreased length, abnormal WT + MO1-gpc4 standard conditions Fig. S7 from Castanon et al., 2013
whole organism decreased length, abnormal WT + MO1-gpc4 standard conditions Fig. S7 from Castanon et al., 2013
whole organism morphology, abnormal WT + MO1-gpc4 standard conditions Fig. 2 with image from Young et al., 2014
notochord increased width, abnormal WT + MO1-gpc4 standard conditions Fig. S7 from Castanon et al., 2013
notochord decreased length, abnormal WT + MO1-gpc4 + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
prechordal plate elongated, abnormal WT + MO1-gpc4 + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
convergent extension disrupted, abnormal WT + MO1-gpc4 + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
whole organism decreased length, abnormal WT + MO1-gpc4 + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
notochord increased width, abnormal WT + MO1-gpc4 + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
anterior neural plate increased width, abnormal WT + MO1-gpc4 + MO3-antxr2a standard conditions Fig. S7 from Castanon et al., 2013
Genome Resources:
CITATIONS (2)