ZFIN ID: ZDB-MRPHLNO-130213-3
Morpholino Name: MO1-mcm2
Target: mcm2 (1)
Sequence:
5' - TGAACGACTCTGAGGAATCCGCCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-mcm2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-mcm2
Expressed Gene Anatomy Figures
foxn1 Fig. 3 with image from Ma et al., 2012
ikzf1 Fig. 3 with image from Ma et al., 2012
il7r Fig. 3 with image from Ma et al., 2012
rag1 Fig. 3 with image from Ma et al., 2012
PHENOTYPE
Phenotype resulting from MO1-mcm2
Phenotype Figures
thymus decreased size, abnormal Fig. 6 with image from Ma et al., 2012
thymus cell population proliferation decreased occurrence, abnormal Fig. 6 with image from Ma et al., 2012
thymus epithelial cell decreased amount, abnormal Fig. 6 with image from Ma et al., 2012

Phenotype of all Fish created by or utilizing MO1-mcm2
Phenotype Fish Conditions Figures
thymus decreased size, abnormal WT + MO1-mcm2 standard conditions Fig. 6 with image from Ma et al., 2012
thymus epithelial cell decreased amount, abnormal WT + MO1-mcm2 standard conditions Fig. 6 with image from Ma et al., 2012
thymus cell population proliferation decreased occurrence, abnormal WT + MO1-mcm2 standard conditions Fig. 6 with image from Ma et al., 2012
OTHER MO1-mcm2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)