ZFIN ID: ZDB-MRPHLNO-130130-2
Morpholino Name: MO3-noto
Target: noto (1)
Previous Name: MO3-flh

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AATCTGCATGGCGTCTGTTTAGTCC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-noto No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-noto No data available
PHENOTYPE
Phenotype resulting from MO3-noto
Phenotype of all Fish created by or utilizing MO3-noto
Genome Resources:
CITATIONS (2)