ZFIN ID: ZDB-MRPHLNO-130122-3
Morpholino Name: MO1-pthlhb
Target: pthlhb (1)
Sequence:
5' - CTGAACGCCGTCTGGAACATAGACA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pthlhb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pthlhb
Expressed Gene Anatomy Figures
runx2b Fig. 6 from Yan et al., 2012
sox9a Fig. 6 from Yan et al., 2012
sox9b Fig. 6 from Yan et al., 2012
sp7 Fig. S3 from Yan et al., 2012
PHENOTYPE
Phenotype resulting from MO1-pthlhb
Phenotype Figures
ceratobranchial bone deformed, abnormal Fig. 7 from Yan et al., 2012
ceratohyal bone deformed, abnormal Fig. 7 from Yan et al., 2012

Phenotype of all Fish created by or utilizing MO1-pthlhb
Phenotype Fish Conditions Figures
ceratohyal bone deformed, abnormal WT + MO1-pthlhb standard conditions Fig. 7 from Yan et al., 2012
ceratobranchial bone deformed, abnormal WT + MO1-pthlhb standard conditions Fig. 7 from Yan et al., 2012
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO1-pthlha + MO1-pthlhb standard conditions Fig. 7 from Yan et al., 2012
splanchnocranium deformed, abnormal WT + MO1-pthlha + MO1-pthlhb standard conditions Fig. 7 from Yan et al., 2012
OTHER MO1-pthlhb MORPHOLINO PAGESNo links to external sites
CITATIONS (1)