ZFIN ID: ZDB-MRPHLNO-130116-1
Morpholino Name: MO2-bves
Target: bves (1)
Sequence:
5' - AGAGCAGCCTGAAAGACAATAAAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-bves No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-bves No data available
PHENOTYPE
Phenotype resulting from MO2-bves
Phenotype Figures
axis decreased length, abnormal Fig. 3 from Wu et al., 2012
axis increased length, abnormal Fig. 3 from Wu et al., 2012
brain malformed, abnormal Fig. 3 from Wu et al., 2012
cardiac ventricle decreased functionality, abnormal Fig. S2-6 from Wang et al., 2016
cardiac ventricle action potential process quality, abnormal Fig. S2-6 from Wang et al., 2016
epidermal cell permeable, abnormal Fig. 5 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal Fig. 3Fig. 5 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal Fig. 5 from Wu et al., 2012
epidermis separated from muscle, abnormal Fig. 3 from Wu et al., 2012
extension decreased length, abnormal Fig. 3 from Wu et al., 2012
eye decreased size, abnormal Fig. 2 from Wu et al., 2014
heart primordium increased size, abnormal Fig. 3 from Wu et al., 2012
immature eye decreased size, abnormal Fig. 3 from Wu et al., 2012
muscle malformed, abnormal Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal Fig. 4 from Wu et al., 2014
outer limiting membrane adherens junction malformed, abnormal Fig. 4 from Wu et al., 2014
pericardium edematous, abnormal Fig. 3 from Wu et al., 2012
post-vent region decreased length, abnormal Fig. 3 from Wu et al., 2012
somite shape, abnormal Fig. 3 from Wu et al., 2012
somitogenesis arrested, abnormal Fig. 3 from Wu et al., 2012
tail bud deformed, abnormal Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal Fig. 3 from Wu et al., 2012
yolk protruding, abnormal Fig. 3 from Wu et al., 2012

Phenotype of all Fish created by or utilizing MO2-bves
Phenotype Fish Conditions Figures
cardiac ventricle action potential process quality, abnormal AB/TU + MO2-bves standard conditions Fig. S2-6 from Wang et al., 2016
cardiac ventricle decreased functionality, abnormal AB/TU + MO2-bves standard conditions Fig. S2-6 from Wang et al., 2016
epidermis separated from muscle, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal WT + MO2-bves standard conditions Fig. 4 from Wu et al., 2014
brain malformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
axis decreased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell permeable, abnormal WT + MO2-bves standard conditions Fig. 5 from Wu et al., 2012
extension decreased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
yolk protruding, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
post-vent region decreased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction malformed, abnormal WT + MO2-bves standard conditions Fig. 4 from Wu et al., 2014
axis increased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
eye decreased size, abnormal WT + MO2-bves standard conditions Fig. 2 from Wu et al., 2014
tail bud deformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
pericardium edematous, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal WT + MO2-bves standard conditions Fig. 5 from Wu et al., 2012
somite shape, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
immature eye decreased size, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
somitogenesis arrested, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
muscle malformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal WT + MO2-bves standard conditions Fig. 3Fig. 5 from Wu et al., 2012
heart primordium increased size, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
OTHER MO2-bves MORPHOLINO PAGESNo links to external sites
CITATIONS (3)