Morpholino

MO2-bves

ID
ZDB-MRPHLNO-130116-1
Name
MO2-bves
Previous Names
None
Target
Sequence
5' - AGAGCAGCCTGAAAGACAATAAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bves
No data available
Phenotype
Phenotype resulting from MO2-bves
Phenotype Fish Figures
axis decreased length, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
axis increased length, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
brain malformed, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
cardiac ventricle decreased functionality, abnormal AB/TU + MO2-bves Fig. S2-6 from Wang et al., 2016
cardiac ventricle action potential process quality, abnormal AB/TU + MO2-bves Fig. S2-6 from Wang et al., 2016
epidermal cell permeable, abnormal WT + MO2-bves Fig. 5 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal WT + MO2-bves Fig. 3,  Fig. 5 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal WT + MO2-bves Fig. 5 from Wu et al., 2012
epidermis separated from muscle, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
extension decreased length, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
eye decreased size, abnormal WT + MO2-bves Fig. 2 from Wu et al., 2014
heart primordium increased size, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
immature eye decreased size, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
muscle malformed, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal WT + MO2-bves Fig. 4 from Wu et al., 2014
outer limiting membrane adherens junction malformed, abnormal WT + MO2-bves Fig. 4 from Wu et al., 2014
pericardium edematous, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
post-vent region decreased length, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
somite shape, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
somitogenesis arrested, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
tail bud deformed, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
yolk protruding, abnormal WT + MO2-bves Fig. 3 from Wu et al., 2012
Phenotype of all Fish created by or utilizing MO2-bves
Phenotype Fish Conditions Figures
cardiac ventricle action potential process quality, abnormal AB/TU + MO2-bves standard conditions Fig. S2-6 from Wang et al., 2016
cardiac ventricle decreased functionality, abnormal AB/TU + MO2-bves standard conditions Fig. S2-6 from Wang et al., 2016
epidermis separated from muscle, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal WT + MO2-bves standard conditions Fig. 4 from Wu et al., 2014
brain malformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
axis decreased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell permeable, abnormal WT + MO2-bves standard conditions Fig. 5 from Wu et al., 2012
extension decreased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
yolk protruding, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
post-vent region decreased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction malformed, abnormal WT + MO2-bves standard conditions Fig. 4 from Wu et al., 2014
axis increased length, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
tail bud deformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
eye decreased size, abnormal WT + MO2-bves standard conditions Fig. 2 from Wu et al., 2014
pericardium edematous, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal WT + MO2-bves standard conditions Fig. 5 from Wu et al., 2012
somite shape, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
immature eye decreased size, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
somitogenesis arrested, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
muscle malformed, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
heart primordium increased size, abnormal WT + MO2-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal WT + MO2-bves standard conditions Fig. 3,  Fig. 5 from Wu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.