header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-130111-2
Morpholino Name: MO1-pthlha
Target: pthlha (1)
Previous Name: e2i2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CACAGACACTTACATTCGGCTGCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pthlha No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pthlha
Expressed Gene Anatomy Figures
runx2b Fig. 6 from Yan et al., 2012
sox9a Fig. 6 from Yan et al., 2012
sox9b Fig. 6 from Yan et al., 2012
sp7 Fig. S3 from Yan et al., 2012
PHENOTYPE
Phenotype resulting from MO1-pthlha
Phenotype of all Fish created by or utilizing MO1-pthlha
OTHER MO1-pthlha MORPHOLINO PAGESNo links to external sites
CITATIONS (1)