ZFIN ID: ZDB-MRPHLNO-130104-1
Morpholino Name: MO1-bves
Target: bves (1)
Sequence:
5' - GATGTTGTGTTGGACATTCTGAGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-bves No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-bves
Expressed Gene Anatomy Figures
bves Fig. 2 from Wu et al., 2014
Fig. 7Fig. 8 from Wu et al., 2012
PHENOTYPE
Phenotype resulting from MO1-bves
Phenotype Figures
axis decreased length, abnormal Fig. 3 from Wu et al., 2012
axis increased length, abnormal Fig. 3 from Wu et al., 2012
brain malformed, abnormal Fig. 3 from Wu et al., 2012
epidermal cell permeable, abnormal Fig. 5 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal Fig. 3Fig. 5 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal Fig. 5 from Wu et al., 2012
epidermis separated from muscle, abnormal Fig. 3 from Wu et al., 2012
extension decreased length, abnormal Fig. 3 from Wu et al., 2012
eye decreased size, abnormal Fig. 2 from Wu et al., 2014
eye photoreceptor cell immature, abnormal Fig. 3 from Wu et al., 2014
eye photoreceptor cell photoreceptor outer segment absent, abnormal Fig. 3 from Wu et al., 2014
green sensitive photoreceptor cell absent, abnormal Fig. 3 from Wu et al., 2014
heart primordium increased size, abnormal Fig. 3 from Wu et al., 2012
immature eye decreased size, abnormal Fig. 3 from Wu et al., 2012
lens decreased size, abnormal Fig. 2 from Wu et al., 2014
muscle malformed, abnormal Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal Fig. 4 from Wu et al., 2014
outer limiting membrane adherens junction malformed, abnormal Fig. 4 from Wu et al., 2014
pericardium edematous, abnormal Fig. 3 from Wu et al., 2012
post-vent region decreased length, abnormal Fig. 3 from Wu et al., 2012
red sensitive photoreceptor cell absent, abnormal Fig. 3 from Wu et al., 2014
retina neuron mislocalised, abnormal Fig. 3 from Wu et al., 2014
retina layer formation decreased process quality, abnormal Fig. 2Fig. 3 from Wu et al., 2014
retinal neural layer absent, abnormal Fig. 2Fig. 3 from Wu et al., 2014
retinal neural layer malformed, abnormal Fig. 2 from Wu et al., 2014
retinal pigmented epithelium detached from retina, abnormal Fig. 2 from Wu et al., 2014
somite shape, abnormal Fig. 3 from Wu et al., 2012
somitogenesis arrested, abnormal Fig. 3 from Wu et al., 2012
tail bud deformed, abnormal Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal Fig. 3 from Wu et al., 2012
yolk protruding, abnormal Fig. 3 from Wu et al., 2012

Phenotype of all Fish created by or utilizing MO1-bves
Phenotype Fish Conditions Figures
somite shape, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell bicellular tight junction decreased length, abnormal WT + MO1-bves standard conditions Fig. 5 from Wu et al., 2012
muscle malformed, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
red sensitive photoreceptor cell absent, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2014
retinal neural layer malformed, abnormal WT + MO1-bves standard conditions Fig. 2 from Wu et al., 2014
retinal neural layer absent, abnormal WT + MO1-bves standard conditions Fig. 2Fig. 3 from Wu et al., 2014
retinal pigmented epithelium detached from retina, abnormal WT + MO1-bves standard conditions Fig. 2 from Wu et al., 2014
somitogenesis arrested, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
lens decreased size, abnormal WT + MO1-bves standard conditions Fig. 2 from Wu et al., 2014
eye photoreceptor cell immature, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2014
immature eye decreased size, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
green sensitive photoreceptor cell absent, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2014
post-vent region decreased length, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell permeable, abnormal WT + MO1-bves standard conditions Fig. 5 from Wu et al., 2012
pericardium edematous, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
retina neuron mislocalised, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2014
heart primordium increased size, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
brain malformed, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
extension decreased length, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
retina layer formation decreased process quality, abnormal WT + MO1-bves standard conditions Fig. 2Fig. 3 from Wu et al., 2014
tail bud deformed, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
whole organism deformed, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
epidermal cell separated from epidermal cell, abnormal WT + MO1-bves standard conditions Fig. 3Fig. 5 from Wu et al., 2012
eye decreased size, abnormal WT + MO1-bves standard conditions Fig. 2 from Wu et al., 2014
axis decreased length, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
epidermis separated from muscle, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
outer limiting membrane adherens junction absent, abnormal WT + MO1-bves standard conditions Fig. 4 from Wu et al., 2014
outer limiting membrane adherens junction malformed, abnormal WT + MO1-bves standard conditions Fig. 4 from Wu et al., 2014
yolk protruding, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
axis increased length, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2012
whole organism hypotrophic, abnormal WT + MO1-bves isotonic Fig. 5 from Wu et al., 2012
eye photoreceptor cell photoreceptor outer segment absent, abnormal WT + MO1-bves standard conditions Fig. 3 from Wu et al., 2014
OTHER MO1-bves MORPHOLINO PAGESNo links to external sites
CITATIONS (2)