ZFIN ID: ZDB-MRPHLNO-121212-1
Morpholino Name: MO1-cdkn2a/b
Target: cdkn2a/b (1)
Previous Name: MO1-cdkn2b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAAAGCGCGTCTAAACCTACCTGTA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cdkn2a/b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cdkn2a/b No data available
PHENOTYPE
Phenotype resulting from MO1-cdkn2a/b
No data available

Phenotype of all Fish created by or utilizing MO1-cdkn2a/b
Phenotype Fish Conditions Figures
brain size, ameliorated TU + MO1-cat7l + MO1-cdkn2a/b standard conditions Fig. 4 from Ray et al., 2016
forebrain decreased volume, abnormal WT + MO1-cdkn2a/b + MO1-chmp1a standard conditions Fig. 3 from Mochida et al., 2012
cerebellum decreased volume, abnormal WT + MO1-cdkn2a/b + MO1-chmp1a standard conditions Fig. 3 from Mochida et al., 2012
cerebellum development disrupted, abnormal WT + MO1-cdkn2a/b + MO1-chmp1a standard conditions Fig. 3 from Mochida et al., 2012
brain size, ameliorated tp53zdf1/zdf1 + MO1-cat7l + MO1-cdkn2a/b standard conditions Fig. 5 from Ray et al., 2016
brain size, ameliorated TU + MO1-bmi1b + MO1-cat7l + MO1-cdkn2a/b + MO2-bmi1a standard conditions Fig. 4 from Ray et al., 2016
brain size, ameliorated tp53zdf1/zdf1 + MO1-bmi1b + MO1-cat7l + MO1-cdkn2a/b + MO2-bmi1a standard conditions Fig. 5 from Ray et al., 2016
OTHER MO1-cdkn2a/b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)