Morpholino

MO1-kif22

ID
ZDB-MRPHLNO-121210-5
Name
MO1-kif22
Previous Names
None
Target
Sequence
5' - CTTTCCTGAGGTGAAGAACAAGAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kif22
No data available
Phenotype
Phenotype resulting from MO1-kif22
Phenotype of all Fish created by or utilizing MO1-kif22
Phenotype Fish Conditions Figures
hindbrain axon decreased length, abnormal WT + MO1-kif22 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
post-vent region shape, abnormal WT + MO1-kif22 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite contractile muscle fiber disorganized, abnormal WT + MO1-kif22 standard conditions Fig. 6 with image from Blaker-Lee et al., 2012
hindbrain axon disorganized, abnormal WT + MO1-kif22 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
brain morphology, abnormal WT + MO1-kif22 standard conditions Fig. 2 with image from Blaker-Lee et al., 2012
post-vent region decreased length, abnormal WT + MO1-kif22 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
thigmotaxis decreased process quality, abnormal WT + MO1-kif22 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-kif22 standard conditions Fig. 3 with image from Blaker-Lee et al., 2012
somite contractile muscle fiber undulate, abnormal WT + MO1-kif22 standard conditions Fig. 6 with image from Blaker-Lee et al., 2012
somite U-shaped, abnormal WT + MO1-kif22 standard conditions Fig. 3 with imageFig. 6 with image from Blaker-Lee et al., 2012
forebrain axon decreased size, abnormal WT + MO1-kif22 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
forebrain axon disorganized, abnormal WT + MO1-kif22 standard conditions Fig. 5 with image from Blaker-Lee et al., 2012
ventricular system morphology, abnormal AB + MO1-doc2a + MO1-kif22 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-doc2a + MO1-kif22 + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-ino80e + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-ino80e + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
ventricular system morphology, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
brain morphology, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S1 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell morphology, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
skeletal muscle cell disorganized, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Fig. S3 with imageTable S2 from McCammon et al., 2017
enteric neuron decreased amount, abnormal AB + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-hirip3 + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-ino80e + MO1-kif22 + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
central nervous system neuron differentiation process quality, abnormal nl1Tg + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
cranial nerve development process quality, abnormal rw0Tg + MO1-kif22 + MO1-taok2b + MO4-tp53 standard conditions Table S2 from McCammon et al., 2017
Citations